Incidental Mutation 'R1725:Stx18'
ID198062
Institutional Source Beutler Lab
Gene Symbol Stx18
Ensembl Gene ENSMUSG00000029125
Gene Namesyntaxin 18
Synonyms1810035L21Rik, 4933425D03Rik
MMRRC Submission 039757-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R1725 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location38038742-38137765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38135255 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 234 (V234M)
Ref Sequence ENSEMBL: ENSMUSP00000118218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031008] [ENSMUST00000031009] [ENSMUST00000042146] [ENSMUST00000114126] [ENSMUST00000154929] [ENSMUST00000201363] [ENSMUST00000201415]
Predicted Effect probably damaging
Transcript: ENSMUST00000031008
AA Change: V288M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031008
Gene: ENSMUSG00000029125
AA Change: V288M

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 4.1e-26 PFAM
low complexity region 196 209 N/A INTRINSIC
coiled coil region 229 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031009
SMART Domains Protein: ENSMUSP00000031009
Gene: ENSMUSG00000029126

DomainStartEndE-ValueType
Pfam:Calcyon 1 180 1.2e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042146
AA Change: V262M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038205
Gene: ENSMUSG00000029125
AA Change: V262M

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 4.1e-26 PFAM
low complexity region 170 183 N/A INTRINSIC
coiled coil region 203 233 N/A INTRINSIC
transmembrane domain 284 306 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114126
AA Change: V288M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109761
Gene: ENSMUSG00000029125
AA Change: V288M

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 3.4e-24 PFAM
low complexity region 196 209 N/A INTRINSIC
coiled coil region 229 259 N/A INTRINSIC
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141286
Predicted Effect probably damaging
Transcript: ENSMUST00000154929
AA Change: V234M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118218
Gene: ENSMUSG00000029125
AA Change: V234M

DomainStartEndE-ValueType
low complexity region 142 155 N/A INTRINSIC
coiled coil region 175 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201363
SMART Domains Protein: ENSMUSP00000144396
Gene: ENSMUSG00000029126

DomainStartEndE-ValueType
Pfam:Calcyon 1 180 1.2e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201415
SMART Domains Protein: ENSMUSP00000143921
Gene: ENSMUSG00000029126

DomainStartEndE-ValueType
Pfam:Calcyon 1 47 7.5e-19 PFAM
Pfam:Calcyon 43 141 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202512
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin family of soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) which is part of a membrane tethering complex that includes other SNAREs and several peripheral membrane proteins, and is involved in vesicular transport between the endoplasmic reticulum (ER) and the Golgi complex. The encoded protein is important for the organization of the smooth, rough, and exit site ER subdomains. A pseudogene of this gene has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T G 19: 58,792,762 K10T probably benign Het
2310079G19Rik A T 16: 88,627,275 F109L probably benign Het
Aacs T C 5: 125,482,935 probably null Het
Abcc6 C A 7: 45,992,357 D866Y possibly damaging Het
Acox3 T C 5: 35,592,172 Y214H probably benign Het
Acss2 A G 2: 155,556,844 T404A possibly damaging Het
Adgrb3 T A 1: 25,826,300 E154V probably damaging Het
Akap12 G A 10: 4,353,942 V251M probably damaging Het
Ambp A T 4: 63,144,276 M242K possibly damaging Het
Angptl7 T G 4: 148,500,012 Y93S probably damaging Het
Apof A G 10: 128,269,811 probably benign Het
Arv1 T C 8: 124,728,452 F135L probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cacna1s C T 1: 136,098,623 T1116I probably damaging Het
Ccdc91 A G 6: 147,592,043 E311G unknown Het
Cenpf T C 1: 189,680,479 T196A probably damaging Het
Chd8 A T 14: 52,232,573 S527T probably benign Het
Csmd3 A C 15: 47,596,807 N3529K probably damaging Het
Csnk2a1 T C 2: 152,257,972 V116A probably damaging Het
Dhx36 T G 3: 62,506,939 M1L probably benign Het
Diaph3 A G 14: 86,966,323 probably null Het
Ephb2 G A 4: 136,659,778 Q714* probably null Het
Eprs T A 1: 185,406,992 L858Q probably damaging Het
Espl1 G T 15: 102,313,221 V982L probably benign Het
Eya2 A G 2: 165,724,685 T219A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl18 C T 5: 142,886,703 R259H probably damaging Het
Gcc2 G A 10: 58,304,115 R1629H possibly damaging Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Kmt2d T C 15: 98,845,234 probably benign Het
Krt6a A T 15: 101,692,557 M268K probably damaging Het
Loxhd1 T A 18: 77,293,241 S85T probably benign Het
Loxl3 G A 6: 83,035,593 V38I probably benign Het
Mill2 A G 7: 18,840,068 D26G probably benign Het
Muc15 T C 2: 110,731,246 L9S probably damaging Het
Nat8f4 G A 6: 85,901,098 R148* probably null Het
Nav3 A T 10: 109,823,590 V722E probably damaging Het
Nfkb1 C A 3: 135,667,758 G10W probably damaging Het
Olfr1477 T C 19: 13,502,519 Y59H probably damaging Het
Olfr16 C T 1: 172,957,341 P182L possibly damaging Het
Olfr31 T G 14: 14,328,977 Y289D probably damaging Het
Olfr705 A T 7: 106,714,058 F208I probably benign Het
Pcdhb22 T A 18: 37,520,188 C313S probably benign Het
Plin4 A G 17: 56,106,473 L384P probably damaging Het
Pm20d1 T C 1: 131,816,058 I487T probably damaging Het
Prex1 A T 2: 166,601,736 D334E probably damaging Het
Psg28 A T 7: 18,428,011 I189N possibly damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rae1 A G 2: 173,006,961 I123M possibly damaging Het
Sh3glb2 C A 2: 30,350,667 E129* probably null Het
Simc1 T C 13: 54,526,406 S856P probably damaging Het
Slc19a1 T A 10: 77,041,838 M69K probably benign Het
Slc30a8 A T 15: 52,333,604 I304F possibly damaging Het
Snx1 A G 9: 66,098,329 probably null Het
Sulf2 T C 2: 166,081,361 T615A probably damaging Het
Sult3a2 T A 10: 33,779,709 K91N probably benign Het
Tet1 A G 10: 62,814,477 S22P probably damaging Het
Tmc3 T C 7: 83,604,732 V362A probably damaging Het
Trim16 A C 11: 62,820,505 M1L possibly damaging Het
Trp53bp1 C T 2: 121,252,000 V10I possibly damaging Het
Ttc12 T G 9: 49,458,115 D235A probably benign Het
Ttn T C 2: 76,862,383 R452G possibly damaging Het
Ugt2b38 A T 5: 87,411,871 H387Q probably damaging Het
Usp48 T A 4: 137,633,422 L20* probably null Het
Utrn T C 10: 12,663,519 D1918G probably damaging Het
Vmn1r158 A G 7: 22,790,647 S46P probably benign Het
Vmn2r97 T A 17: 18,929,135 W262R probably benign Het
Vps13d A T 4: 145,143,260 S1917T possibly damaging Het
Vsx1 T C 2: 150,686,200 N158D probably benign Het
Vwf G A 6: 125,646,282 V1781I probably benign Het
Wrap73 T C 4: 154,148,752 Y128H possibly damaging Het
Zfp472 A G 17: 32,977,337 K129E possibly damaging Het
Zscan18 A T 7: 12,770,857 L611Q probably damaging Het
Other mutations in Stx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Stx18 APN 5 38106611 missense possibly damaging 0.86
IGL02123:Stx18 APN 5 38128103 missense probably damaging 1.00
IGL03107:Stx18 APN 5 38136311 missense probably damaging 1.00
IGL03187:Stx18 APN 5 38126983 missense possibly damaging 0.94
R0025:Stx18 UTSW 5 38092564 missense probably damaging 1.00
R0025:Stx18 UTSW 5 38092564 missense probably damaging 1.00
R0414:Stx18 UTSW 5 38105005 splice site probably benign
R0713:Stx18 UTSW 5 38106671 intron probably null
R1147:Stx18 UTSW 5 38126923 splice site probably benign
R1552:Stx18 UTSW 5 38104991 missense probably damaging 0.99
R1929:Stx18 UTSW 5 38128039 splice site probably null
R2020:Stx18 UTSW 5 38135244 missense probably damaging 1.00
R4678:Stx18 UTSW 5 38136368 unclassified probably benign
R5247:Stx18 UTSW 5 38106633 missense probably damaging 1.00
R6056:Stx18 UTSW 5 38106564 missense probably damaging 0.96
R6330:Stx18 UTSW 5 38126917 unclassified probably null
R6860:Stx18 UTSW 5 38104891 missense possibly damaging 0.62
R7060:Stx18 UTSW 5 38121255 missense possibly damaging 0.87
X0026:Stx18 UTSW 5 38104966 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTGGTCAGAGTCCCACTGAAAG -3'
(R):5'- AGCTGCAAGGTGGACCCTAAACAC -3'

Sequencing Primer
(F):5'- GGAGCACTAGCTGTACTTCAG -3'
(R):5'- CTACACAGTATTCTTGGACAACCTC -3'
Posted On2014-05-23