Incidental Mutation 'R1725:Trim16'
ID198090
Institutional Source Beutler Lab
Gene Symbol Trim16
Ensembl Gene ENSMUSG00000047821
Gene Nametripartite motif-containing 16
SynonymsEBBP, 9130006M08Rik
MMRRC Submission 039757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R1725 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location62820231-62850808 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to C at 62820505 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000072432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055006] [ENSMUST00000072639] [ENSMUST00000108703]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055006
AA Change: M1L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055542
Gene: ENSMUSG00000047821
AA Change: M1L

DomainStartEndE-ValueType
Blast:BBOX 64 113 6e-24 BLAST
BBOX 117 157 3.24e-4 SMART
coiled coil region 171 196 N/A INTRINSIC
coiled coil region 237 265 N/A INTRINSIC
PRY 364 417 1.41e-22 SMART
SPRY 418 543 6.4e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072639
AA Change: M1L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072432
Gene: ENSMUSG00000047821
AA Change: M1L

DomainStartEndE-ValueType
Blast:BBOX 64 113 5e-24 BLAST
BBOX 117 157 3.24e-4 SMART
coiled coil region 171 196 N/A INTRINSIC
coiled coil region 237 265 N/A INTRINSIC
PRY 364 417 1.41e-22 SMART
Pfam:SPRY 418 483 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108703
SMART Domains Protein: ENSMUSP00000104343
Gene: ENSMUSG00000047821

DomainStartEndE-ValueType
Blast:BBOX 1 26 9e-10 BLAST
BBOX 30 70 3.24e-4 SMART
coiled coil region 84 109 N/A INTRINSIC
coiled coil region 150 178 N/A INTRINSIC
PRY 277 330 1.41e-22 SMART
SPRY 331 456 6.4e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147942
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tripartite motif (TRIM) family member that contains two B box domains and a coiled-coiled region that are characteristic of the B box zinc finger protein family. While it lacks a RING domain found in other TRIM proteins, the encoded protein can homodimerize or heterodimerize with other TRIM proteins and has E3 ubiquitin ligase activity. This gene is also a tumor suppressor and is involved in secretory autophagy. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T G 19: 58,792,762 K10T probably benign Het
2310079G19Rik A T 16: 88,627,275 F109L probably benign Het
Aacs T C 5: 125,482,935 probably null Het
Abcc6 C A 7: 45,992,357 D866Y possibly damaging Het
Acox3 T C 5: 35,592,172 Y214H probably benign Het
Acss2 A G 2: 155,556,844 T404A possibly damaging Het
Adgrb3 T A 1: 25,826,300 E154V probably damaging Het
Akap12 G A 10: 4,353,942 V251M probably damaging Het
Ambp A T 4: 63,144,276 M242K possibly damaging Het
Angptl7 T G 4: 148,500,012 Y93S probably damaging Het
Apof A G 10: 128,269,811 probably benign Het
Arv1 T C 8: 124,728,452 F135L probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cacna1s C T 1: 136,098,623 T1116I probably damaging Het
Ccdc91 A G 6: 147,592,043 E311G unknown Het
Cenpf T C 1: 189,680,479 T196A probably damaging Het
Chd8 A T 14: 52,232,573 S527T probably benign Het
Csmd3 A C 15: 47,596,807 N3529K probably damaging Het
Csnk2a1 T C 2: 152,257,972 V116A probably damaging Het
Dhx36 T G 3: 62,506,939 M1L probably benign Het
Diaph3 A G 14: 86,966,323 probably null Het
Ephb2 G A 4: 136,659,778 Q714* probably null Het
Eprs T A 1: 185,406,992 L858Q probably damaging Het
Espl1 G T 15: 102,313,221 V982L probably benign Het
Eya2 A G 2: 165,724,685 T219A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl18 C T 5: 142,886,703 R259H probably damaging Het
Gcc2 G A 10: 58,304,115 R1629H possibly damaging Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Kmt2d T C 15: 98,845,234 probably benign Het
Krt6a A T 15: 101,692,557 M268K probably damaging Het
Loxhd1 T A 18: 77,293,241 S85T probably benign Het
Loxl3 G A 6: 83,035,593 V38I probably benign Het
Mill2 A G 7: 18,840,068 D26G probably benign Het
Muc15 T C 2: 110,731,246 L9S probably damaging Het
Nat8f4 G A 6: 85,901,098 R148* probably null Het
Nav3 A T 10: 109,823,590 V722E probably damaging Het
Nfkb1 C A 3: 135,667,758 G10W probably damaging Het
Olfr1477 T C 19: 13,502,519 Y59H probably damaging Het
Olfr16 C T 1: 172,957,341 P182L possibly damaging Het
Olfr31 T G 14: 14,328,977 Y289D probably damaging Het
Olfr705 A T 7: 106,714,058 F208I probably benign Het
Pcdhb22 T A 18: 37,520,188 C313S probably benign Het
Plin4 A G 17: 56,106,473 L384P probably damaging Het
Pm20d1 T C 1: 131,816,058 I487T probably damaging Het
Prex1 A T 2: 166,601,736 D334E probably damaging Het
Psg28 A T 7: 18,428,011 I189N possibly damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rae1 A G 2: 173,006,961 I123M possibly damaging Het
Sh3glb2 C A 2: 30,350,667 E129* probably null Het
Simc1 T C 13: 54,526,406 S856P probably damaging Het
Slc19a1 T A 10: 77,041,838 M69K probably benign Het
Slc30a8 A T 15: 52,333,604 I304F possibly damaging Het
Snx1 A G 9: 66,098,329 probably null Het
Stx18 G A 5: 38,135,255 V234M probably damaging Het
Sulf2 T C 2: 166,081,361 T615A probably damaging Het
Sult3a2 T A 10: 33,779,709 K91N probably benign Het
Tet1 A G 10: 62,814,477 S22P probably damaging Het
Tmc3 T C 7: 83,604,732 V362A probably damaging Het
Trp53bp1 C T 2: 121,252,000 V10I possibly damaging Het
Ttc12 T G 9: 49,458,115 D235A probably benign Het
Ttn T C 2: 76,862,383 R452G possibly damaging Het
Ugt2b38 A T 5: 87,411,871 H387Q probably damaging Het
Usp48 T A 4: 137,633,422 L20* probably null Het
Utrn T C 10: 12,663,519 D1918G probably damaging Het
Vmn1r158 A G 7: 22,790,647 S46P probably benign Het
Vmn2r97 T A 17: 18,929,135 W262R probably benign Het
Vps13d A T 4: 145,143,260 S1917T possibly damaging Het
Vsx1 T C 2: 150,686,200 N158D probably benign Het
Vwf G A 6: 125,646,282 V1781I probably benign Het
Wrap73 T C 4: 154,148,752 Y128H possibly damaging Het
Zfp472 A G 17: 32,977,337 K129E possibly damaging Het
Zscan18 A T 7: 12,770,857 L611Q probably damaging Het
Other mutations in Trim16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Trim16 APN 11 62837232 splice site probably benign
IGL01060:Trim16 APN 11 62820704 missense probably benign 0.06
IGL01568:Trim16 APN 11 62820858 missense probably benign 0.05
IGL01659:Trim16 APN 11 62820695 missense probably benign 0.00
IGL02519:Trim16 APN 11 62834079 missense possibly damaging 0.49
IGL02662:Trim16 APN 11 62840557 missense possibly damaging 0.91
FR4589:Trim16 UTSW 11 62820695 intron probably benign
FR4976:Trim16 UTSW 11 62820689 intron probably benign
R0007:Trim16 UTSW 11 62829118 missense probably benign 0.00
R0007:Trim16 UTSW 11 62829118 missense probably benign 0.00
R0346:Trim16 UTSW 11 62840694 missense probably benign 0.00
R0410:Trim16 UTSW 11 62820471 start gained probably benign
R3845:Trim16 UTSW 11 62836672 splice site probably benign
R3879:Trim16 UTSW 11 62840607 missense probably damaging 1.00
R5023:Trim16 UTSW 11 62836812 missense probably benign 0.36
R5344:Trim16 UTSW 11 62820925 missense probably damaging 1.00
R6919:Trim16 UTSW 11 62840869 missense possibly damaging 0.86
X0026:Trim16 UTSW 11 62829137 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGCGTGAATGAGTCCCGTAAG -3'
(R):5'- GTAGTTCACCATGCAGGTCAGACAG -3'

Sequencing Primer
(F):5'- CTACTAGCCAATCTGGAGGAGC -3'
(R):5'- GGTCAGACAGGATTTCACTGC -3'
Posted On2014-05-23