Incidental Mutation 'R1725:Ptk2'
ID198103
Institutional Source Beutler Lab
Gene Symbol Ptk2
Ensembl Gene ENSMUSG00000022607
Gene NamePTK2 protein tyrosine kinase 2
SynonymsFRNK, FAK, Fadk
MMRRC Submission 039757-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1725 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location73205102-73423280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73242406 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 701 (V701A)
Ref Sequence ENSEMBL: ENSMUSP00000105663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000170939] [ENSMUST00000226988] [ENSMUST00000227395] [ENSMUST00000227686]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110036
AA Change: V701A

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: V701A

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 288 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Pfam:Focal_AT 914 1046 5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170939
AA Change: V701A

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126764
Gene: ENSMUSG00000022607
AA Change: V701A

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 287 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226742
Predicted Effect probably benign
Transcript: ENSMUST00000226988
AA Change: V701A

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000227395
AA Change: V11A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227569
Predicted Effect probably benign
Transcript: ENSMUST00000227686
AA Change: V27A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228628
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T G 19: 58,792,762 K10T probably benign Het
2310079G19Rik A T 16: 88,627,275 F109L probably benign Het
Aacs T C 5: 125,482,935 probably null Het
Abcc6 C A 7: 45,992,357 D866Y possibly damaging Het
Acox3 T C 5: 35,592,172 Y214H probably benign Het
Acss2 A G 2: 155,556,844 T404A possibly damaging Het
Adgrb3 T A 1: 25,826,300 E154V probably damaging Het
Akap12 G A 10: 4,353,942 V251M probably damaging Het
Ambp A T 4: 63,144,276 M242K possibly damaging Het
Angptl7 T G 4: 148,500,012 Y93S probably damaging Het
Apof A G 10: 128,269,811 probably benign Het
Arv1 T C 8: 124,728,452 F135L probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cacna1s C T 1: 136,098,623 T1116I probably damaging Het
Ccdc91 A G 6: 147,592,043 E311G unknown Het
Cenpf T C 1: 189,680,479 T196A probably damaging Het
Chd8 A T 14: 52,232,573 S527T probably benign Het
Csmd3 A C 15: 47,596,807 N3529K probably damaging Het
Csnk2a1 T C 2: 152,257,972 V116A probably damaging Het
Dhx36 T G 3: 62,506,939 M1L probably benign Het
Diaph3 A G 14: 86,966,323 probably null Het
Ephb2 G A 4: 136,659,778 Q714* probably null Het
Eprs T A 1: 185,406,992 L858Q probably damaging Het
Espl1 G T 15: 102,313,221 V982L probably benign Het
Eya2 A G 2: 165,724,685 T219A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl18 C T 5: 142,886,703 R259H probably damaging Het
Gcc2 G A 10: 58,304,115 R1629H possibly damaging Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Kmt2d T C 15: 98,845,234 probably benign Het
Krt6a A T 15: 101,692,557 M268K probably damaging Het
Loxhd1 T A 18: 77,293,241 S85T probably benign Het
Loxl3 G A 6: 83,035,593 V38I probably benign Het
Mill2 A G 7: 18,840,068 D26G probably benign Het
Muc15 T C 2: 110,731,246 L9S probably damaging Het
Nat8f4 G A 6: 85,901,098 R148* probably null Het
Nav3 A T 10: 109,823,590 V722E probably damaging Het
Nfkb1 C A 3: 135,667,758 G10W probably damaging Het
Olfr1477 T C 19: 13,502,519 Y59H probably damaging Het
Olfr16 C T 1: 172,957,341 P182L possibly damaging Het
Olfr31 T G 14: 14,328,977 Y289D probably damaging Het
Olfr705 A T 7: 106,714,058 F208I probably benign Het
Pcdhb22 T A 18: 37,520,188 C313S probably benign Het
Plin4 A G 17: 56,106,473 L384P probably damaging Het
Pm20d1 T C 1: 131,816,058 I487T probably damaging Het
Prex1 A T 2: 166,601,736 D334E probably damaging Het
Psg28 A T 7: 18,428,011 I189N possibly damaging Het
Rae1 A G 2: 173,006,961 I123M possibly damaging Het
Sh3glb2 C A 2: 30,350,667 E129* probably null Het
Simc1 T C 13: 54,526,406 S856P probably damaging Het
Slc19a1 T A 10: 77,041,838 M69K probably benign Het
Slc30a8 A T 15: 52,333,604 I304F possibly damaging Het
Snx1 A G 9: 66,098,329 probably null Het
Stx18 G A 5: 38,135,255 V234M probably damaging Het
Sulf2 T C 2: 166,081,361 T615A probably damaging Het
Sult3a2 T A 10: 33,779,709 K91N probably benign Het
Tet1 A G 10: 62,814,477 S22P probably damaging Het
Tmc3 T C 7: 83,604,732 V362A probably damaging Het
Trim16 A C 11: 62,820,505 M1L possibly damaging Het
Trp53bp1 C T 2: 121,252,000 V10I possibly damaging Het
Ttc12 T G 9: 49,458,115 D235A probably benign Het
Ttn T C 2: 76,862,383 R452G possibly damaging Het
Ugt2b38 A T 5: 87,411,871 H387Q probably damaging Het
Usp48 T A 4: 137,633,422 L20* probably null Het
Utrn T C 10: 12,663,519 D1918G probably damaging Het
Vmn1r158 A G 7: 22,790,647 S46P probably benign Het
Vmn2r97 T A 17: 18,929,135 W262R probably benign Het
Vps13d A T 4: 145,143,260 S1917T possibly damaging Het
Vsx1 T C 2: 150,686,200 N158D probably benign Het
Vwf G A 6: 125,646,282 V1781I probably benign Het
Wrap73 T C 4: 154,148,752 Y128H possibly damaging Het
Zfp472 A G 17: 32,977,337 K129E possibly damaging Het
Zscan18 A T 7: 12,770,857 L611Q probably damaging Het
Other mutations in Ptk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Ptk2 APN 15 73262547 missense probably damaging 1.00
IGL00913:Ptk2 APN 15 73295389 splice site probably benign
IGL01605:Ptk2 APN 15 73264339 splice site probably benign
IGL01631:Ptk2 APN 15 73216371 missense probably damaging 1.00
IGL01952:Ptk2 APN 15 73229931 missense probably damaging 0.99
IGL01957:Ptk2 APN 15 73242473 missense probably benign 0.05
IGL02441:Ptk2 APN 15 73320826 missense probably benign 0.16
IGL02471:Ptk2 APN 15 73298187 missense probably benign 0.41
IGL02621:Ptk2 APN 15 73206145 missense probably damaging 0.99
IGL03198:Ptk2 APN 15 73236216 missense probably damaging 1.00
Shooter UTSW 15 73304444 missense possibly damaging 0.83
R0239:Ptk2 UTSW 15 73343283 unclassified probably null
R0239:Ptk2 UTSW 15 73343283 unclassified probably null
R1254:Ptk2 UTSW 15 73229970 missense probably benign 0.01
R1291:Ptk2 UTSW 15 73210756 missense probably damaging 1.00
R1307:Ptk2 UTSW 15 73292046 missense probably benign 0.01
R1608:Ptk2 UTSW 15 73262575 missense probably damaging 0.98
R1690:Ptk2 UTSW 15 73262610 missense probably damaging 1.00
R1724:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1740:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1741:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1840:Ptk2 UTSW 15 73210884 missense probably damaging 1.00
R1956:Ptk2 UTSW 15 73215983 missense possibly damaging 0.49
R2022:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2092:Ptk2 UTSW 15 73236191 nonsense probably null
R2114:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2115:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2336:Ptk2 UTSW 15 73266116 missense probably damaging 1.00
R2571:Ptk2 UTSW 15 73231919 missense probably damaging 1.00
R4232:Ptk2 UTSW 15 73309849 missense possibly damaging 0.61
R4245:Ptk2 UTSW 15 73231976 missense probably benign 0.00
R4594:Ptk2 UTSW 15 73206196 missense probably damaging 1.00
R4688:Ptk2 UTSW 15 73206225 missense probably damaging 1.00
R4834:Ptk2 UTSW 15 73216096 splice site probably null
R4847:Ptk2 UTSW 15 73231956 missense probably benign
R5558:Ptk2 UTSW 15 73304445 missense probably damaging 0.97
R5682:Ptk2 UTSW 15 73262564 nonsense probably null
R5858:Ptk2 UTSW 15 73321095 missense probably benign 0.12
R5951:Ptk2 UTSW 15 73303833 missense possibly damaging 0.88
R6014:Ptk2 UTSW 15 73304444 missense possibly damaging 0.83
R6027:Ptk2 UTSW 15 73229913 missense probably damaging 1.00
R6082:Ptk2 UTSW 15 73276865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAGCAGCATATCGGGCAATC -3'
(R):5'- TACAGTCAGCCGGAGACATGTAGG -3'

Sequencing Primer
(F):5'- AGCATATCGGGCAATCTACAG -3'
(R):5'- CCTTTTGAGTGAGGCTAGAAACC -3'
Posted On2014-05-23