Incidental Mutation 'R1725:Plin4'
ID198114
Institutional Source Beutler Lab
Gene Symbol Plin4
Ensembl Gene ENSMUSG00000002831
Gene Nameperilipin 4
SynonymsS3-12
MMRRC Submission 039757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1725 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56100591-56109803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56106473 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 384 (L384P)
Ref Sequence ENSEMBL: ENSMUSP00000139859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002908] [ENSMUST00000190703]
Predicted Effect probably damaging
Transcript: ENSMUST00000002908
AA Change: L384P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002908
Gene: ENSMUSG00000002831
AA Change: L384P

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
low complexity region 1124 1136 N/A INTRINSIC
Pfam:Perilipin 1144 1385 2.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190703
AA Change: L384P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139859
Gene: ENSMUSG00000002831
AA Change: L384P

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
Pfam:Perilipin 1110 1385 1.4e-16 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the perilipin family, such as PLIN4, coat intracellular lipid storage droplets (Wolins et al., 2003 [PubMed 12840023]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased triglyceride in the heart and protection from cardiac steatosis induced by prolonged fasting, feeding or genetic obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T G 19: 58,792,762 K10T probably benign Het
2310079G19Rik A T 16: 88,627,275 F109L probably benign Het
Aacs T C 5: 125,482,935 probably null Het
Abcc6 C A 7: 45,992,357 D866Y possibly damaging Het
Acox3 T C 5: 35,592,172 Y214H probably benign Het
Acss2 A G 2: 155,556,844 T404A possibly damaging Het
Adgrb3 T A 1: 25,826,300 E154V probably damaging Het
Akap12 G A 10: 4,353,942 V251M probably damaging Het
Ambp A T 4: 63,144,276 M242K possibly damaging Het
Angptl7 T G 4: 148,500,012 Y93S probably damaging Het
Apof A G 10: 128,269,811 probably benign Het
Arv1 T C 8: 124,728,452 F135L probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cacna1s C T 1: 136,098,623 T1116I probably damaging Het
Ccdc91 A G 6: 147,592,043 E311G unknown Het
Cenpf T C 1: 189,680,479 T196A probably damaging Het
Chd8 A T 14: 52,232,573 S527T probably benign Het
Csmd3 A C 15: 47,596,807 N3529K probably damaging Het
Csnk2a1 T C 2: 152,257,972 V116A probably damaging Het
Dhx36 T G 3: 62,506,939 M1L probably benign Het
Diaph3 A G 14: 86,966,323 probably null Het
Ephb2 G A 4: 136,659,778 Q714* probably null Het
Eprs T A 1: 185,406,992 L858Q probably damaging Het
Espl1 G T 15: 102,313,221 V982L probably benign Het
Eya2 A G 2: 165,724,685 T219A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl18 C T 5: 142,886,703 R259H probably damaging Het
Gcc2 G A 10: 58,304,115 R1629H possibly damaging Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Kmt2d T C 15: 98,845,234 probably benign Het
Krt6a A T 15: 101,692,557 M268K probably damaging Het
Loxhd1 T A 18: 77,293,241 S85T probably benign Het
Loxl3 G A 6: 83,035,593 V38I probably benign Het
Mill2 A G 7: 18,840,068 D26G probably benign Het
Muc15 T C 2: 110,731,246 L9S probably damaging Het
Nat8f4 G A 6: 85,901,098 R148* probably null Het
Nav3 A T 10: 109,823,590 V722E probably damaging Het
Nfkb1 C A 3: 135,667,758 G10W probably damaging Het
Olfr1477 T C 19: 13,502,519 Y59H probably damaging Het
Olfr16 C T 1: 172,957,341 P182L possibly damaging Het
Olfr31 T G 14: 14,328,977 Y289D probably damaging Het
Olfr705 A T 7: 106,714,058 F208I probably benign Het
Pcdhb22 T A 18: 37,520,188 C313S probably benign Het
Pm20d1 T C 1: 131,816,058 I487T probably damaging Het
Prex1 A T 2: 166,601,736 D334E probably damaging Het
Psg28 A T 7: 18,428,011 I189N possibly damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rae1 A G 2: 173,006,961 I123M possibly damaging Het
Sh3glb2 C A 2: 30,350,667 E129* probably null Het
Simc1 T C 13: 54,526,406 S856P probably damaging Het
Slc19a1 T A 10: 77,041,838 M69K probably benign Het
Slc30a8 A T 15: 52,333,604 I304F possibly damaging Het
Snx1 A G 9: 66,098,329 probably null Het
Stx18 G A 5: 38,135,255 V234M probably damaging Het
Sulf2 T C 2: 166,081,361 T615A probably damaging Het
Sult3a2 T A 10: 33,779,709 K91N probably benign Het
Tet1 A G 10: 62,814,477 S22P probably damaging Het
Tmc3 T C 7: 83,604,732 V362A probably damaging Het
Trim16 A C 11: 62,820,505 M1L possibly damaging Het
Trp53bp1 C T 2: 121,252,000 V10I possibly damaging Het
Ttc12 T G 9: 49,458,115 D235A probably benign Het
Ttn T C 2: 76,862,383 R452G possibly damaging Het
Ugt2b38 A T 5: 87,411,871 H387Q probably damaging Het
Usp48 T A 4: 137,633,422 L20* probably null Het
Utrn T C 10: 12,663,519 D1918G probably damaging Het
Vmn1r158 A G 7: 22,790,647 S46P probably benign Het
Vmn2r97 T A 17: 18,929,135 W262R probably benign Het
Vps13d A T 4: 145,143,260 S1917T possibly damaging Het
Vsx1 T C 2: 150,686,200 N158D probably benign Het
Vwf G A 6: 125,646,282 V1781I probably benign Het
Wrap73 T C 4: 154,148,752 Y128H possibly damaging Het
Zfp472 A G 17: 32,977,337 K129E possibly damaging Het
Zscan18 A T 7: 12,770,857 L611Q probably damaging Het
Other mutations in Plin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Plin4 APN 17 56107362 missense probably damaging 0.98
IGL02121:Plin4 APN 17 56102131 missense probably damaging 0.98
IGL02254:Plin4 APN 17 56104733 missense probably damaging 0.98
IGL02539:Plin4 APN 17 56106680 missense probably damaging 1.00
IGL02892:Plin4 APN 17 56105108 missense probably damaging 1.00
IGL03051:Plin4 APN 17 56105417 missense possibly damaging 0.91
IGL03258:Plin4 APN 17 56104371 missense probably benign 0.05
R0211:Plin4 UTSW 17 56102242 missense probably damaging 1.00
R0365:Plin4 UTSW 17 56104667 missense possibly damaging 0.93
R0545:Plin4 UTSW 17 56106567 missense probably damaging 1.00
R0551:Plin4 UTSW 17 56106756 missense probably benign 0.03
R0862:Plin4 UTSW 17 56103966 missense probably benign 0.00
R0864:Plin4 UTSW 17 56103966 missense probably benign 0.00
R1260:Plin4 UTSW 17 56104348 nonsense probably null
R1650:Plin4 UTSW 17 56104931 missense probably damaging 0.99
R1688:Plin4 UTSW 17 56109363 missense possibly damaging 0.61
R1803:Plin4 UTSW 17 56104931 missense probably damaging 0.99
R1834:Plin4 UTSW 17 56103522 missense probably damaging 0.97
R1953:Plin4 UTSW 17 56103849 missense possibly damaging 0.49
R2860:Plin4 UTSW 17 56106668 missense probably damaging 0.98
R2861:Plin4 UTSW 17 56106668 missense probably damaging 0.98
R2915:Plin4 UTSW 17 56104389 missense probably damaging 0.98
R3438:Plin4 UTSW 17 56107193 missense probably benign 0.26
R3622:Plin4 UTSW 17 56104112 missense possibly damaging 0.92
R3932:Plin4 UTSW 17 56106704 missense probably benign 0.01
R4116:Plin4 UTSW 17 56102113 missense probably benign 0.30
R4201:Plin4 UTSW 17 56104338 missense probably damaging 1.00
R4529:Plin4 UTSW 17 56104274 missense probably damaging 1.00
R4610:Plin4 UTSW 17 56105418 missense probably benign 0.08
R4692:Plin4 UTSW 17 56103762 missense probably damaging 1.00
R4693:Plin4 UTSW 17 56103762 missense probably damaging 1.00
R4718:Plin4 UTSW 17 56106981 missense possibly damaging 0.46
R5283:Plin4 UTSW 17 56106777 missense probably benign 0.00
R5304:Plin4 UTSW 17 56106132 missense probably benign 0.00
R5333:Plin4 UTSW 17 56104970 missense probably benign 0.31
R5484:Plin4 UTSW 17 56104932 missense possibly damaging 0.90
R5569:Plin4 UTSW 17 56102147 missense probably benign 0.02
R5765:Plin4 UTSW 17 56102470 missense possibly damaging 0.68
R5776:Plin4 UTSW 17 56104983 missense probably damaging 0.99
R5828:Plin4 UTSW 17 56107064 missense probably damaging 0.99
R5932:Plin4 UTSW 17 56106356 missense possibly damaging 0.92
R5988:Plin4 UTSW 17 56109567 missense probably benign 0.03
R6053:Plin4 UTSW 17 56108618 missense probably benign 0.01
R6264:Plin4 UTSW 17 56104787 missense possibly damaging 0.90
R6334:Plin4 UTSW 17 56103261 missense probably benign 0.22
R6415:Plin4 UTSW 17 56103264 missense probably damaging 1.00
R7030:Plin4 UTSW 17 56103969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTTTAGCCACATTCAAGGCCC -3'
(R):5'- TCATAGGCACCAAGGATACGGTGAC -3'

Sequencing Primer
(F):5'- ATTCAAGGCCCCTGTGAGTC -3'
(R):5'- ATACGGTGACCACAGGGC -3'
Posted On2014-05-23