Incidental Mutation 'R1725:Olfr1477'
ID198118
Institutional Source Beutler Lab
Gene Symbol Olfr1477
Ensembl Gene ENSMUSG00000071629
Gene Nameolfactory receptor 1477
SynonymsMOR202-10, GA_x6K02T2RE5P-3834960-3835907
MMRRC Submission 039757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1725 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13500546-13506192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13502519 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 59 (Y59H)
Ref Sequence ENSEMBL: ENSMUSP00000149565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096201] [ENSMUST00000214274] [ENSMUST00000217001]
Predicted Effect probably damaging
Transcript: ENSMUST00000096201
AA Change: Y59H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093915
Gene: ENSMUSG00000095189
AA Change: Y59H

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 34 304 2.6e-6 PFAM
Pfam:7tm_1 40 289 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208393
Predicted Effect probably damaging
Transcript: ENSMUST00000214274
AA Change: Y59H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217001
AA Change: Y59H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T G 19: 58,792,762 K10T probably benign Het
2310079G19Rik A T 16: 88,627,275 F109L probably benign Het
Aacs T C 5: 125,482,935 probably null Het
Abcc6 C A 7: 45,992,357 D866Y possibly damaging Het
Acox3 T C 5: 35,592,172 Y214H probably benign Het
Acss2 A G 2: 155,556,844 T404A possibly damaging Het
Adgrb3 T A 1: 25,826,300 E154V probably damaging Het
Akap12 G A 10: 4,353,942 V251M probably damaging Het
Ambp A T 4: 63,144,276 M242K possibly damaging Het
Angptl7 T G 4: 148,500,012 Y93S probably damaging Het
Apof A G 10: 128,269,811 probably benign Het
Arv1 T C 8: 124,728,452 F135L probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cacna1s C T 1: 136,098,623 T1116I probably damaging Het
Ccdc91 A G 6: 147,592,043 E311G unknown Het
Cenpf T C 1: 189,680,479 T196A probably damaging Het
Chd8 A T 14: 52,232,573 S527T probably benign Het
Csmd3 A C 15: 47,596,807 N3529K probably damaging Het
Csnk2a1 T C 2: 152,257,972 V116A probably damaging Het
Dhx36 T G 3: 62,506,939 M1L probably benign Het
Diaph3 A G 14: 86,966,323 probably null Het
Ephb2 G A 4: 136,659,778 Q714* probably null Het
Eprs T A 1: 185,406,992 L858Q probably damaging Het
Espl1 G T 15: 102,313,221 V982L probably benign Het
Eya2 A G 2: 165,724,685 T219A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl18 C T 5: 142,886,703 R259H probably damaging Het
Gcc2 G A 10: 58,304,115 R1629H possibly damaging Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Kmt2d T C 15: 98,845,234 probably benign Het
Krt6a A T 15: 101,692,557 M268K probably damaging Het
Loxhd1 T A 18: 77,293,241 S85T probably benign Het
Loxl3 G A 6: 83,035,593 V38I probably benign Het
Mill2 A G 7: 18,840,068 D26G probably benign Het
Muc15 T C 2: 110,731,246 L9S probably damaging Het
Nat8f4 G A 6: 85,901,098 R148* probably null Het
Nav3 A T 10: 109,823,590 V722E probably damaging Het
Nfkb1 C A 3: 135,667,758 G10W probably damaging Het
Olfr16 C T 1: 172,957,341 P182L possibly damaging Het
Olfr31 T G 14: 14,328,977 Y289D probably damaging Het
Olfr705 A T 7: 106,714,058 F208I probably benign Het
Pcdhb22 T A 18: 37,520,188 C313S probably benign Het
Plin4 A G 17: 56,106,473 L384P probably damaging Het
Pm20d1 T C 1: 131,816,058 I487T probably damaging Het
Prex1 A T 2: 166,601,736 D334E probably damaging Het
Psg28 A T 7: 18,428,011 I189N possibly damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rae1 A G 2: 173,006,961 I123M possibly damaging Het
Sh3glb2 C A 2: 30,350,667 E129* probably null Het
Simc1 T C 13: 54,526,406 S856P probably damaging Het
Slc19a1 T A 10: 77,041,838 M69K probably benign Het
Slc30a8 A T 15: 52,333,604 I304F possibly damaging Het
Snx1 A G 9: 66,098,329 probably null Het
Stx18 G A 5: 38,135,255 V234M probably damaging Het
Sulf2 T C 2: 166,081,361 T615A probably damaging Het
Sult3a2 T A 10: 33,779,709 K91N probably benign Het
Tet1 A G 10: 62,814,477 S22P probably damaging Het
Tmc3 T C 7: 83,604,732 V362A probably damaging Het
Trim16 A C 11: 62,820,505 M1L possibly damaging Het
Trp53bp1 C T 2: 121,252,000 V10I possibly damaging Het
Ttc12 T G 9: 49,458,115 D235A probably benign Het
Ttn T C 2: 76,862,383 R452G possibly damaging Het
Ugt2b38 A T 5: 87,411,871 H387Q probably damaging Het
Usp48 T A 4: 137,633,422 L20* probably null Het
Utrn T C 10: 12,663,519 D1918G probably damaging Het
Vmn1r158 A G 7: 22,790,647 S46P probably benign Het
Vmn2r97 T A 17: 18,929,135 W262R probably benign Het
Vps13d A T 4: 145,143,260 S1917T possibly damaging Het
Vsx1 T C 2: 150,686,200 N158D probably benign Het
Vwf G A 6: 125,646,282 V1781I probably benign Het
Wrap73 T C 4: 154,148,752 Y128H possibly damaging Het
Zfp472 A G 17: 32,977,337 K129E possibly damaging Het
Zscan18 A T 7: 12,770,857 L611Q probably damaging Het
Other mutations in Olfr1477
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Olfr1477 APN 19 13502741 missense possibly damaging 0.55
IGL02394:Olfr1477 APN 19 13502864 missense probably damaging 0.97
R0047:Olfr1477 UTSW 19 13502589 missense probably benign 0.30
R0047:Olfr1477 UTSW 19 13502589 missense probably benign 0.30
R0356:Olfr1477 UTSW 19 13503077 missense possibly damaging 0.74
R0617:Olfr1477 UTSW 19 13502536 missense probably damaging 1.00
R1589:Olfr1477 UTSW 19 13502757 missense probably benign 0.03
R2153:Olfr1477 UTSW 19 13502488 missense probably damaging 1.00
R2362:Olfr1477 UTSW 19 13502508 missense probably damaging 1.00
R3402:Olfr1477 UTSW 19 13502948 missense probably benign 0.11
R4513:Olfr1477 UTSW 19 13502622 missense probably benign 0.05
R5197:Olfr1477 UTSW 19 13502384 missense possibly damaging 0.68
R5205:Olfr1477 UTSW 19 13502799 missense probably damaging 1.00
R5511:Olfr1477 UTSW 19 13503192 missense probably benign 0.12
R5838:Olfr1477 UTSW 19 13502558 missense probably damaging 1.00
R6023:Olfr1477 UTSW 19 13502703 missense probably damaging 1.00
R6232:Olfr1477 UTSW 19 13503063 missense probably damaging 1.00
R6700:Olfr1477 UTSW 19 13502813 missense probably damaging 0.97
R6769:Olfr1477 UTSW 19 13502954 missense possibly damaging 0.83
R6771:Olfr1477 UTSW 19 13502954 missense possibly damaging 0.83
R7002:Olfr1477 UTSW 19 13502675 missense probably benign 0.00
R7057:Olfr1477 UTSW 19 13502879 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATTCCCACCCAGAATTCAGATGAG -3'
(R):5'- ACACTGCTGCATGACGGTCATAGG -3'

Sequencing Primer
(F):5'- AAAATCGCTTGCTGATGTCC -3'
(R):5'- CATGACGGTCATAGGCCATTG -3'
Posted On2014-05-23