Incidental Mutation 'R1726:Ikzf2'
ID198121
Institutional Source Beutler Lab
Gene Symbol Ikzf2
Ensembl Gene ENSMUSG00000025997
Gene NameIKAROS family zinc finger 2
SynonymsA730095J18Rik, Zfpn1a2, Helios
MMRRC Submission 039758-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R1726 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location69531214-69687245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69548688 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 214 (R214L)
Ref Sequence ENSEMBL: ENSMUSP00000139543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027146] [ENSMUST00000187184] [ENSMUST00000188110] [ENSMUST00000190771] [ENSMUST00000190855] [ENSMUST00000191262]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027146
AA Change: R208L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027146
Gene: ENSMUSG00000025997
AA Change: R208L

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 112 134 7.67e-2 SMART
ZnF_C2H2 140 162 1.72e-4 SMART
ZnF_C2H2 168 190 3.95e-4 SMART
ZnF_C2H2 196 219 3.58e-2 SMART
ZnF_C2H2 471 493 9.46e0 SMART
ZnF_C2H2 499 523 6.13e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187100
Predicted Effect probably damaging
Transcript: ENSMUST00000187184
AA Change: R182L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141075
Gene: ENSMUSG00000025997
AA Change: R182L

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 1.72e-4 SMART
ZnF_C2H2 142 164 3.95e-4 SMART
ZnF_C2H2 170 193 3.58e-2 SMART
ZnF_C2H2 445 467 9.46e0 SMART
ZnF_C2H2 473 497 6.13e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188110
SMART Domains Protein: ENSMUSP00000140069
Gene: ENSMUSG00000025997

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 7.3e-7 SMART
ZnF_C2H2 142 164 1.6e-6 SMART
ZnF_C2H2 399 421 4e-2 SMART
ZnF_C2H2 427 451 2.6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190771
AA Change: R214L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139543
Gene: ENSMUSG00000025997
AA Change: R214L

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
ZnF_C2H2 118 140 3.2e-4 SMART
ZnF_C2H2 146 168 7.3e-7 SMART
ZnF_C2H2 174 196 1.6e-6 SMART
ZnF_C2H2 202 225 1.5e-4 SMART
ZnF_C2H2 477 499 4e-2 SMART
ZnF_C2H2 505 529 2.6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190855
AA Change: R182L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140043
Gene: ENSMUSG00000025997
AA Change: R182L

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 7.3e-7 SMART
ZnF_C2H2 142 164 1.6e-6 SMART
ZnF_C2H2 170 193 1.5e-4 SMART
ZnF_C2H2 397 419 4e-2 SMART
ZnF_C2H2 425 449 2.6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191262
AA Change: R63L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139530
Gene: ENSMUSG00000025997
AA Change: R63L

DomainStartEndE-ValueType
ZnF_C2H2 51 74 1.5e-4 SMART
ZnF_C2H2 326 348 4e-2 SMART
ZnF_C2H2 354 378 2.6e-3 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This protein forms homo- or hetero-dimers with other Ikaros family members, and is thought to function predominantly in early hematopoietic development. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit postnatal lethality for unknown reasons. Survivors have decreased body weight. Postnatal lethality has complete penetrance on the C57BL/6 strain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,467,868 I561T possibly damaging Het
Abcb5 G C 12: 118,874,801 probably null Het
Abcb5 A T 12: 118,907,532 S711T possibly damaging Het
Acoxl G A 2: 127,880,446 G216R probably damaging Het
Arhgef18 A T 8: 3,454,228 N949I possibly damaging Het
Brip1 A T 11: 86,064,914 S924R probably benign Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc141 A G 2: 77,108,356 probably benign Het
Ccdc80 A T 16: 45,096,005 T375S probably benign Het
Ccl11 A G 11: 82,061,720 K40E possibly damaging Het
Chrnb2 A T 3: 89,761,202 C269S probably damaging Het
Dgat2 A G 7: 99,182,416 S33P possibly damaging Het
Dip2c A G 13: 9,575,428 D608G probably damaging Het
Dnah2 A T 11: 69,497,889 D889E probably damaging Het
Dvl2 A T 11: 70,009,461 T694S probably benign Het
Fam196a T C 7: 134,899,138 probably benign Het
Fbf1 A G 11: 116,145,454 V1100A probably benign Het
Galt G A 4: 41,756,001 W22* probably null Het
Garem1 C A 18: 21,148,262 V346L probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm10762 A T 2: 128,967,215 probably benign Het
Gm21900 A G Y: 10,616,358 probably null Het
Gm2663 T C 6: 40,998,026 Y37C probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5134 C A 10: 75,992,527 P314T possibly damaging Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
H2-T24 T A 17: 36,015,621 M129L probably benign Het
Itpr3 T A 17: 27,111,690 L1691Q probably damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrp10 T C 14: 54,469,656 L650P probably damaging Het
Mcm9 G A 10: 53,537,881 P368S possibly damaging Het
Mob3b A G 4: 34,954,028 M214T probably benign Het
Mrpl1 T C 5: 96,223,827 V71A probably benign Het
Mrpl57 A G 14: 57,826,635 E40G probably damaging Het
Mtmr9 A G 14: 63,537,098 V162A possibly damaging Het
Nalcn A T 14: 123,308,404 V1065E probably damaging Het
Nemp2 A G 1: 52,637,395 D42G probably damaging Het
Npepps A G 11: 97,224,669 L623P probably damaging Het
Olfr16 A G 1: 172,957,091 T99A probably benign Het
Olfr513 T C 7: 108,755,008 S51P probably benign Het
Olfr742 T A 14: 50,516,179 probably null Het
Olig3 A G 10: 19,356,734 S36G probably benign Het
Pcdhb14 T A 18: 37,449,594 Y584* probably null Het
Pcyox1l T C 18: 61,697,778 Y341C probably benign Het
Pdxdc1 A C 16: 13,838,300 probably null Het
Pias4 A C 10: 81,155,855 V313G probably damaging Het
Pkd1 C T 17: 24,564,176 T81M probably damaging Het
Ptprm T C 17: 67,042,327 I40M probably damaging Het
Reep6 T C 10: 80,335,120 S277P probably benign Het
Shank3 A G 15: 89,557,986 E1694G probably damaging Het
Shq1 T C 6: 100,637,035 Y274C probably benign Het
Slc12a6 T A 2: 112,347,426 I630N probably damaging Het
Slc14a1 T A 18: 78,116,466 N15Y probably benign Het
Slc17a4 A T 13: 23,905,591 Y114* probably null Het
Slc26a1 C T 5: 108,673,675 G116D probably damaging Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Tlr11 A T 14: 50,361,541 H328L probably benign Het
Ube2c G T 2: 164,771,317 A52S probably damaging Het
Uhrf1bp1 C A 17: 27,886,251 probably null Het
Unc5c A G 3: 141,818,103 S806G probably damaging Het
Zfp874b A T 13: 67,474,720 I153K probably damaging Het
Zkscan2 T A 7: 123,489,823 E408D probably damaging Het
Other mutations in Ikzf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Ikzf2 APN 1 69539322 missense possibly damaging 0.77
IGL01295:Ikzf2 APN 1 69577987 missense probably benign 0.13
IGL01313:Ikzf2 APN 1 69539430 missense probably damaging 0.98
IGL01390:Ikzf2 APN 1 69570642 missense probably damaging 1.00
IGL01862:Ikzf2 APN 1 69538898 missense probably damaging 0.99
Freefall UTSW 1 69539097 nonsense probably null
R1079:Ikzf2 UTSW 1 69539105 missense possibly damaging 0.62
R1368:Ikzf2 UTSW 1 69539315 missense possibly damaging 0.95
R1661:Ikzf2 UTSW 1 69538814 missense probably damaging 0.99
R1665:Ikzf2 UTSW 1 69538814 missense probably damaging 0.99
R1688:Ikzf2 UTSW 1 69542280 missense possibly damaging 0.77
R1829:Ikzf2 UTSW 1 69542287 missense probably benign 0.34
R1860:Ikzf2 UTSW 1 69570502 missense probably damaging 1.00
R2507:Ikzf2 UTSW 1 69539288 missense probably benign 0.11
R4457:Ikzf2 UTSW 1 69684188 unclassified probably benign
R5633:Ikzf2 UTSW 1 69539097 nonsense probably null
R5666:Ikzf2 UTSW 1 69577900 missense probably benign 0.04
R5670:Ikzf2 UTSW 1 69577900 missense probably benign 0.04
R5836:Ikzf2 UTSW 1 69539387 missense probably damaging 1.00
R5950:Ikzf2 UTSW 1 69683244 missense probably damaging 1.00
R6492:Ikzf2 UTSW 1 69539042 missense probably damaging 1.00
R6758:Ikzf2 UTSW 1 69538900 missense probably damaging 0.97
R6809:Ikzf2 UTSW 1 69570502 missense probably damaging 1.00
R6946:Ikzf2 UTSW 1 69577796 nonsense probably null
R6959:Ikzf2 UTSW 1 69538770 makesense probably null
X0027:Ikzf2 UTSW 1 69577852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTCATGTCAACTGCTGAGGAAG -3'
(R):5'- TGCCCAAATTGGAGTGTGGAGG -3'

Sequencing Primer
(F):5'- GGAAACACAGTCAGGTTTTGTC -3'
(R):5'- GTGGAAGAGACTGTCTGAAGAGC -3'
Posted On2014-05-23