Incidental Mutation 'R1726:Ccdc141'
ID198123
Institutional Source Beutler Lab
Gene Symbol Ccdc141
Ensembl Gene ENSMUSG00000044033
Gene Namecoiled-coil domain containing 141
SynonymsENSMUSG00000075261, 2610301F02Rik, CAMDI
MMRRC Submission 039758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1726 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location77009902-77170636 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 77108356 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049544] [ENSMUST00000164114]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028406
Predicted Effect probably benign
Transcript: ENSMUST00000049544
SMART Domains Protein: ENSMUSP00000052945
Gene: ENSMUSG00000044033

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 1e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 2e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 9e-63 BLAST
low complexity region 1203 1231 N/A INTRINSIC
Blast:IG 1305 1416 5e-54 BLAST
SCOP:d1g1ca_ 1406 1443 1e-9 SMART
Blast:IG 1416 1444 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131660
Predicted Effect probably benign
Transcript: ENSMUST00000164114
SMART Domains Protein: ENSMUSP00000128736
Gene: ENSMUSG00000044033

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 2e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 3e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 1e-62 BLAST
low complexity region 1203 1231 N/A INTRINSIC
IGc2 1422 1489 1.27e-5 SMART
transmembrane domain 1510 1529 N/A INTRINSIC
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Homozygous knockout impairs migration of neurons in the somatosensory cortex, resulting in increased anxiety and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,467,868 I561T possibly damaging Het
Abcb5 G C 12: 118,874,801 probably null Het
Abcb5 A T 12: 118,907,532 S711T possibly damaging Het
Acoxl G A 2: 127,880,446 G216R probably damaging Het
Arhgef18 A T 8: 3,454,228 N949I possibly damaging Het
Brip1 A T 11: 86,064,914 S924R probably benign Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc80 A T 16: 45,096,005 T375S probably benign Het
Ccl11 A G 11: 82,061,720 K40E possibly damaging Het
Chrnb2 A T 3: 89,761,202 C269S probably damaging Het
Dgat2 A G 7: 99,182,416 S33P possibly damaging Het
Dip2c A G 13: 9,575,428 D608G probably damaging Het
Dnah2 A T 11: 69,497,889 D889E probably damaging Het
Dvl2 A T 11: 70,009,461 T694S probably benign Het
Fam196a T C 7: 134,899,138 probably benign Het
Fbf1 A G 11: 116,145,454 V1100A probably benign Het
Galt G A 4: 41,756,001 W22* probably null Het
Garem1 C A 18: 21,148,262 V346L probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm10762 A T 2: 128,967,215 probably benign Het
Gm21900 A G Y: 10,616,358 probably null Het
Gm2663 T C 6: 40,998,026 Y37C probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5134 C A 10: 75,992,527 P314T possibly damaging Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
H2-T24 T A 17: 36,015,621 M129L probably benign Het
Ikzf2 C A 1: 69,548,688 R214L probably damaging Het
Itpr3 T A 17: 27,111,690 L1691Q probably damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrp10 T C 14: 54,469,656 L650P probably damaging Het
Mcm9 G A 10: 53,537,881 P368S possibly damaging Het
Mob3b A G 4: 34,954,028 M214T probably benign Het
Mrpl1 T C 5: 96,223,827 V71A probably benign Het
Mrpl57 A G 14: 57,826,635 E40G probably damaging Het
Mtmr9 A G 14: 63,537,098 V162A possibly damaging Het
Nalcn A T 14: 123,308,404 V1065E probably damaging Het
Nemp2 A G 1: 52,637,395 D42G probably damaging Het
Npepps A G 11: 97,224,669 L623P probably damaging Het
Olfr16 A G 1: 172,957,091 T99A probably benign Het
Olfr513 T C 7: 108,755,008 S51P probably benign Het
Olfr742 T A 14: 50,516,179 probably null Het
Olig3 A G 10: 19,356,734 S36G probably benign Het
Pcdhb14 T A 18: 37,449,594 Y584* probably null Het
Pcyox1l T C 18: 61,697,778 Y341C probably benign Het
Pdxdc1 A C 16: 13,838,300 probably null Het
Pias4 A C 10: 81,155,855 V313G probably damaging Het
Pkd1 C T 17: 24,564,176 T81M probably damaging Het
Ptprm T C 17: 67,042,327 I40M probably damaging Het
Reep6 T C 10: 80,335,120 S277P probably benign Het
Shank3 A G 15: 89,557,986 E1694G probably damaging Het
Shq1 T C 6: 100,637,035 Y274C probably benign Het
Slc12a6 T A 2: 112,347,426 I630N probably damaging Het
Slc14a1 T A 18: 78,116,466 N15Y probably benign Het
Slc17a4 A T 13: 23,905,591 Y114* probably null Het
Slc26a1 C T 5: 108,673,675 G116D probably damaging Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Tlr11 A T 14: 50,361,541 H328L probably benign Het
Ube2c G T 2: 164,771,317 A52S probably damaging Het
Uhrf1bp1 C A 17: 27,886,251 probably null Het
Unc5c A G 3: 141,818,103 S806G probably damaging Het
Zfp874b A T 13: 67,474,720 I153K probably damaging Het
Zkscan2 T A 7: 123,489,823 E408D probably damaging Het
Other mutations in Ccdc141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Ccdc141 APN 2 77054644 missense probably damaging 0.98
IGL01396:Ccdc141 APN 2 77128325 missense possibly damaging 0.87
IGL01408:Ccdc141 APN 2 77045679 missense probably benign 0.01
IGL01633:Ccdc141 APN 2 77089249 missense probably benign 0.01
IGL01982:Ccdc141 APN 2 77030659 missense probably damaging 1.00
IGL02105:Ccdc141 APN 2 77049577 critical splice donor site probably null
IGL02307:Ccdc141 APN 2 77029342 missense probably damaging 1.00
IGL02645:Ccdc141 APN 2 77074867 nonsense probably null
IGL02737:Ccdc141 APN 2 77057924 missense probably damaging 0.97
IGL02740:Ccdc141 APN 2 77054609 missense probably benign 0.05
IGL02949:Ccdc141 APN 2 77027594 missense probably damaging 1.00
IGL03127:Ccdc141 APN 2 77029235 critical splice donor site probably null
verloren UTSW 2 77027648 missense probably damaging 1.00
verschied UTSW 2 77108356 splice site probably benign
R0153:Ccdc141 UTSW 2 77165238 intron probably benign
R0384:Ccdc141 UTSW 2 77027648 missense probably damaging 1.00
R0423:Ccdc141 UTSW 2 77039450 missense probably damaging 0.96
R0573:Ccdc141 UTSW 2 77039493 missense probably benign 0.00
R1332:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1336:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1355:Ccdc141 UTSW 2 77030601 missense probably damaging 1.00
R1416:Ccdc141 UTSW 2 77014796 missense probably damaging 1.00
R1659:Ccdc141 UTSW 2 77054683 missense probably benign 0.41
R1799:Ccdc141 UTSW 2 77011671 missense possibly damaging 0.88
R1837:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1839:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1918:Ccdc141 UTSW 2 77014703 missense probably benign 0.00
R2019:Ccdc141 UTSW 2 77011565 missense probably damaging 1.00
R2133:Ccdc141 UTSW 2 77059607 missense probably benign 0.28
R2158:Ccdc141 UTSW 2 77030671 missense probably damaging 1.00
R2256:Ccdc141 UTSW 2 77132262 missense probably damaging 1.00
R2359:Ccdc141 UTSW 2 77170402 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77011542 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77074998 missense probably benign 0.11
R3110:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R3112:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R4334:Ccdc141 UTSW 2 77170432 missense probably damaging 1.00
R4493:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4494:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4628:Ccdc141 UTSW 2 77059680 missense probably benign 0.02
R4748:Ccdc141 UTSW 2 77057980 missense possibly damaging 0.67
R4810:Ccdc141 UTSW 2 77045755 missense possibly damaging 0.73
R4824:Ccdc141 UTSW 2 77124336 missense probably damaging 0.99
R4829:Ccdc141 UTSW 2 77074916 missense probably damaging 0.99
R4920:Ccdc141 UTSW 2 77168563 missense probably damaging 1.00
R5024:Ccdc141 UTSW 2 77054703 missense probably benign 0.17
R5073:Ccdc141 UTSW 2 77124378 splice site probably null
R5251:Ccdc141 UTSW 2 77027774 missense probably damaging 1.00
R5252:Ccdc141 UTSW 2 77132249 missense probably benign 0.03
R5534:Ccdc141 UTSW 2 77057897 missense probably benign
R5539:Ccdc141 UTSW 2 77015093 missense probably damaging 0.98
R5551:Ccdc141 UTSW 2 77014409 missense probably damaging 1.00
R5784:Ccdc141 UTSW 2 77029327 missense probably damaging 1.00
R5837:Ccdc141 UTSW 2 77108437 missense possibly damaging 0.56
R5850:Ccdc141 UTSW 2 77029403 missense probably damaging 0.98
R6050:Ccdc141 UTSW 2 77011731 missense probably benign 0.33
R6263:Ccdc141 UTSW 2 77108463 missense probably damaging 1.00
R6502:Ccdc141 UTSW 2 77170401 missense probably damaging 1.00
R6580:Ccdc141 UTSW 2 77011755 missense possibly damaging 0.50
R6865:Ccdc141 UTSW 2 77029235 critical splice donor site probably null
R7014:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R7094:Ccdc141 UTSW 2 77041453 missense possibly damaging 0.83
R7195:Ccdc141 UTSW 2 77049583 missense probably benign 0.39
R7300:Ccdc141 UTSW 2 77014694 missense probably benign 0.00
Z1088:Ccdc141 UTSW 2 77128272 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCACCTCTGCCTGGGATAAGAC -3'
(R):5'- TGCCCTTAAGCATTGAGAGGCTG -3'

Sequencing Primer
(F):5'- CTCTGCCTGGGATAAGACTTAAC -3'
(R):5'- GAAAGGTTGCACTACTGTGTC -3'
Posted On2014-05-23