Incidental Mutation 'R1726:Fam196a'
ID198146
Institutional Source Beutler Lab
Gene Symbol Fam196a
Ensembl Gene ENSMUSG00000073805
Gene Namefamily with sequence similarity 196, member A
Synonyms
MMRRC Submission 039758-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1726 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location134881926-134938430 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 134899138 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084488] [ENSMUST00000171394]
Predicted Effect probably benign
Transcript: ENSMUST00000084488
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171394
SMART Domains Protein: ENSMUSP00000129222
Gene: ENSMUSG00000073805

DomainStartEndE-ValueType
Pfam:FAM196 1 470 4.7e-205 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210617
Meta Mutation Damage Score 0.0464 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 97% (63/65)
MGI Phenotype Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,467,868 I561T possibly damaging Het
Abcb5 G C 12: 118,874,801 probably null Het
Abcb5 A T 12: 118,907,532 S711T possibly damaging Het
Acoxl G A 2: 127,880,446 G216R probably damaging Het
Arhgef18 A T 8: 3,454,228 N949I possibly damaging Het
Brip1 A T 11: 86,064,914 S924R probably benign Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc141 A G 2: 77,108,356 probably benign Het
Ccdc80 A T 16: 45,096,005 T375S probably benign Het
Ccl11 A G 11: 82,061,720 K40E possibly damaging Het
Chrnb2 A T 3: 89,761,202 C269S probably damaging Het
Dgat2 A G 7: 99,182,416 S33P possibly damaging Het
Dip2c A G 13: 9,575,428 D608G probably damaging Het
Dnah2 A T 11: 69,497,889 D889E probably damaging Het
Dvl2 A T 11: 70,009,461 T694S probably benign Het
Fbf1 A G 11: 116,145,454 V1100A probably benign Het
Galt G A 4: 41,756,001 W22* probably null Het
Garem1 C A 18: 21,148,262 V346L probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm10762 A T 2: 128,967,215 probably benign Het
Gm21900 A G Y: 10,616,358 probably null Het
Gm2663 T C 6: 40,998,026 Y37C probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5134 C A 10: 75,992,527 P314T possibly damaging Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
H2-T24 T A 17: 36,015,621 M129L probably benign Het
Ikzf2 C A 1: 69,548,688 R214L probably damaging Het
Itpr3 T A 17: 27,111,690 L1691Q probably damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrp10 T C 14: 54,469,656 L650P probably damaging Het
Mcm9 G A 10: 53,537,881 P368S possibly damaging Het
Mob3b A G 4: 34,954,028 M214T probably benign Het
Mrpl1 T C 5: 96,223,827 V71A probably benign Het
Mrpl57 A G 14: 57,826,635 E40G probably damaging Het
Mtmr9 A G 14: 63,537,098 V162A possibly damaging Het
Nalcn A T 14: 123,308,404 V1065E probably damaging Het
Nemp2 A G 1: 52,637,395 D42G probably damaging Het
Npepps A G 11: 97,224,669 L623P probably damaging Het
Olfr16 A G 1: 172,957,091 T99A probably benign Het
Olfr513 T C 7: 108,755,008 S51P probably benign Het
Olfr742 T A 14: 50,516,179 probably null Het
Olig3 A G 10: 19,356,734 S36G probably benign Het
Pcdhb14 T A 18: 37,449,594 Y584* probably null Het
Pcyox1l T C 18: 61,697,778 Y341C probably benign Het
Pdxdc1 A C 16: 13,838,300 probably null Het
Pias4 A C 10: 81,155,855 V313G probably damaging Het
Pkd1 C T 17: 24,564,176 T81M probably damaging Het
Ptprm T C 17: 67,042,327 I40M probably damaging Het
Reep6 T C 10: 80,335,120 S277P probably benign Het
Shank3 A G 15: 89,557,986 E1694G probably damaging Het
Shq1 T C 6: 100,637,035 Y274C probably benign Het
Slc12a6 T A 2: 112,347,426 I630N probably damaging Het
Slc14a1 T A 18: 78,116,466 N15Y probably benign Het
Slc17a4 A T 13: 23,905,591 Y114* probably null Het
Slc26a1 C T 5: 108,673,675 G116D probably damaging Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Tlr11 A T 14: 50,361,541 H328L probably benign Het
Ube2c G T 2: 164,771,317 A52S probably damaging Het
Uhrf1bp1 C A 17: 27,886,251 probably null Het
Unc5c A G 3: 141,818,103 S806G probably damaging Het
Zfp874b A T 13: 67,474,720 I153K probably damaging Het
Zkscan2 T A 7: 123,489,823 E408D probably damaging Het
Other mutations in Fam196a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01504:Fam196a APN 7 134917940 missense probably benign 0.15
IGL02380:Fam196a APN 7 134899144 critical splice donor site probably null
R0557:Fam196a UTSW 7 134918705 missense probably damaging 1.00
R1421:Fam196a UTSW 7 134899231 splice site probably benign
R1691:Fam196a UTSW 7 134918286 missense probably damaging 1.00
R2045:Fam196a UTSW 7 134918430 missense probably damaging 1.00
R2259:Fam196a UTSW 7 134917667 missense probably damaging 1.00
R3078:Fam196a UTSW 7 134918021 missense probably benign 0.15
R3851:Fam196a UTSW 7 134884526 missense probably benign 0.23
R4619:Fam196a UTSW 7 134918541 missense probably damaging 1.00
R4663:Fam196a UTSW 7 134899148 nonsense probably null
R5024:Fam196a UTSW 7 134918478 missense probably damaging 1.00
R5067:Fam196a UTSW 7 134918555 missense probably benign 0.01
R5195:Fam196a UTSW 7 134884416 missense probably damaging 1.00
R5708:Fam196a UTSW 7 134918796 missense probably damaging 1.00
R6195:Fam196a UTSW 7 134918648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGACCGCAGTTCTGTACTCAAG -3'
(R):5'- ACAAGCATCTCATACCGGGAAGGC -3'

Sequencing Primer
(F):5'- TTGTTCCTGAGCCCACAAAGG -3'
(R):5'- GCCACCGATTGTAACACTCT -3'
Posted On2014-05-23