Incidental Mutation 'R1726:Uhrf1bp1'
ID198180
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1
Ensembl Gene ENSMUSG00000039512
Gene NameUHRF1 (ICBP90) binding protein 1
Synonyms1110020K19Rik, F830021D11Rik
MMRRC Submission 039758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1726 (G1)
Quality Score193
Status Validated
Chromosome17
Chromosomal Location27856490-27900040 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 27886251 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114849]
Predicted Effect probably null
Transcript: ENSMUST00000114849
SMART Domains Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512

DomainStartEndE-ValueType
Pfam:Chorein_N 1 104 2.6e-18 PFAM
low complexity region 234 247 N/A INTRINSIC
low complexity region 297 306 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
low complexity region 1200 1216 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1375 1386 N/A INTRINSIC
coiled coil region 1394 1424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137825
Meta Mutation Damage Score 0.6368 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,467,868 I561T possibly damaging Het
Abcb5 G C 12: 118,874,801 probably null Het
Abcb5 A T 12: 118,907,532 S711T possibly damaging Het
Acoxl G A 2: 127,880,446 G216R probably damaging Het
Arhgef18 A T 8: 3,454,228 N949I possibly damaging Het
Brip1 A T 11: 86,064,914 S924R probably benign Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc141 A G 2: 77,108,356 probably benign Het
Ccdc80 A T 16: 45,096,005 T375S probably benign Het
Ccl11 A G 11: 82,061,720 K40E possibly damaging Het
Chrnb2 A T 3: 89,761,202 C269S probably damaging Het
Dgat2 A G 7: 99,182,416 S33P possibly damaging Het
Dip2c A G 13: 9,575,428 D608G probably damaging Het
Dnah2 A T 11: 69,497,889 D889E probably damaging Het
Dvl2 A T 11: 70,009,461 T694S probably benign Het
Fam196a T C 7: 134,899,138 probably benign Het
Fbf1 A G 11: 116,145,454 V1100A probably benign Het
Galt G A 4: 41,756,001 W22* probably null Het
Garem1 C A 18: 21,148,262 V346L probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm10762 A T 2: 128,967,215 probably benign Het
Gm21900 A G Y: 10,616,358 probably null Het
Gm2663 T C 6: 40,998,026 Y37C probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5134 C A 10: 75,992,527 P314T possibly damaging Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
H2-T24 T A 17: 36,015,621 M129L probably benign Het
Ikzf2 C A 1: 69,548,688 R214L probably damaging Het
Itpr3 T A 17: 27,111,690 L1691Q probably damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrp10 T C 14: 54,469,656 L650P probably damaging Het
Mcm9 G A 10: 53,537,881 P368S possibly damaging Het
Mob3b A G 4: 34,954,028 M214T probably benign Het
Mrpl1 T C 5: 96,223,827 V71A probably benign Het
Mrpl57 A G 14: 57,826,635 E40G probably damaging Het
Mtmr9 A G 14: 63,537,098 V162A possibly damaging Het
Nalcn A T 14: 123,308,404 V1065E probably damaging Het
Nemp2 A G 1: 52,637,395 D42G probably damaging Het
Npepps A G 11: 97,224,669 L623P probably damaging Het
Olfr16 A G 1: 172,957,091 T99A probably benign Het
Olfr513 T C 7: 108,755,008 S51P probably benign Het
Olfr742 T A 14: 50,516,179 probably null Het
Olig3 A G 10: 19,356,734 S36G probably benign Het
Pcdhb14 T A 18: 37,449,594 Y584* probably null Het
Pcyox1l T C 18: 61,697,778 Y341C probably benign Het
Pdxdc1 A C 16: 13,838,300 probably null Het
Pias4 A C 10: 81,155,855 V313G probably damaging Het
Pkd1 C T 17: 24,564,176 T81M probably damaging Het
Ptprm T C 17: 67,042,327 I40M probably damaging Het
Reep6 T C 10: 80,335,120 S277P probably benign Het
Shank3 A G 15: 89,557,986 E1694G probably damaging Het
Shq1 T C 6: 100,637,035 Y274C probably benign Het
Slc12a6 T A 2: 112,347,426 I630N probably damaging Het
Slc14a1 T A 18: 78,116,466 N15Y probably benign Het
Slc17a4 A T 13: 23,905,591 Y114* probably null Het
Slc26a1 C T 5: 108,673,675 G116D probably damaging Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Tlr11 A T 14: 50,361,541 H328L probably benign Het
Ube2c G T 2: 164,771,317 A52S probably damaging Het
Unc5c A G 3: 141,818,103 S806G probably damaging Het
Zfp874b A T 13: 67,474,720 I153K probably damaging Het
Zkscan2 T A 7: 123,489,823 E408D probably damaging Het
Other mutations in Uhrf1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Uhrf1bp1 APN 17 27876917 splice site probably benign
IGL00786:Uhrf1bp1 APN 17 27879292 missense probably damaging 0.99
IGL01074:Uhrf1bp1 APN 17 27879291 missense possibly damaging 0.94
IGL01780:Uhrf1bp1 APN 17 27893500 missense probably damaging 1.00
IGL02668:Uhrf1bp1 APN 17 27886575 missense possibly damaging 0.53
IGL02686:Uhrf1bp1 APN 17 27894589 missense probably benign
IGL03240:Uhrf1bp1 APN 17 27893253 missense probably benign 0.37
hades UTSW 17 27894746 missense probably damaging 1.00
R0167:Uhrf1bp1 UTSW 17 27880202 missense possibly damaging 0.46
R0240:Uhrf1bp1 UTSW 17 27895870 splice site probably benign
R0332:Uhrf1bp1 UTSW 17 27893294 critical splice donor site probably null
R0668:Uhrf1bp1 UTSW 17 27895939 missense probably benign 0.16
R0726:Uhrf1bp1 UTSW 17 27885489 missense possibly damaging 0.50
R0964:Uhrf1bp1 UTSW 17 27887178 missense probably damaging 0.96
R1125:Uhrf1bp1 UTSW 17 27893449 missense probably damaging 1.00
R1139:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1164:Uhrf1bp1 UTSW 17 27895380 critical splice donor site probably null
R1192:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1277:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1279:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1340:Uhrf1bp1 UTSW 17 27894721 missense probably benign 0.00
R1341:Uhrf1bp1 UTSW 17 27877419 splice site probably benign
R1344:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1418:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1552:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1791:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R1796:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R2858:Uhrf1bp1 UTSW 17 27885462 missense probably damaging 0.99
R3034:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R4111:Uhrf1bp1 UTSW 17 27886090 nonsense probably null
R4159:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4160:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4161:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4431:Uhrf1bp1 UTSW 17 27885931 missense probably damaging 1.00
R4575:Uhrf1bp1 UTSW 17 27887503 missense probably benign 0.02
R4657:Uhrf1bp1 UTSW 17 27890105 missense probably benign 0.09
R4666:Uhrf1bp1 UTSW 17 27893503 missense possibly damaging 0.95
R4825:Uhrf1bp1 UTSW 17 27877394 missense probably damaging 0.98
R4872:Uhrf1bp1 UTSW 17 27890136 missense probably benign 0.10
R4956:Uhrf1bp1 UTSW 17 27889984 intron probably null
R4976:Uhrf1bp1 UTSW 17 27884026 missense probably damaging 0.99
R4982:Uhrf1bp1 UTSW 17 27886606 missense probably benign 0.05
R5017:Uhrf1bp1 UTSW 17 27894739 nonsense probably null
R5033:Uhrf1bp1 UTSW 17 27886864 missense probably damaging 0.99
R5137:Uhrf1bp1 UTSW 17 27876990 intron probably null
R5159:Uhrf1bp1 UTSW 17 27881556 missense probably damaging 0.98
R5177:Uhrf1bp1 UTSW 17 27885018 missense possibly damaging 0.94
R5196:Uhrf1bp1 UTSW 17 27856763 missense probably benign 0.09
R5214:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5352:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5354:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5425:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5601:Uhrf1bp1 UTSW 17 27884494 missense probably damaging 1.00
R6080:Uhrf1bp1 UTSW 17 27880297 missense probably benign
R6088:Uhrf1bp1 UTSW 17 27884605 critical splice donor site probably null
R6331:Uhrf1bp1 UTSW 17 27893201 missense probably benign 0.01
R6529:Uhrf1bp1 UTSW 17 27879776 missense possibly damaging 0.90
R6614:Uhrf1bp1 UTSW 17 27876925 missense probably benign 0.18
R6701:Uhrf1bp1 UTSW 17 27887357 nonsense probably null
X0017:Uhrf1bp1 UTSW 17 27877341 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTGTCAGCTTGCTTTGGGGAAAC -3'
(R):5'- AAGAACTCGGTGGCAGCGAATC -3'

Sequencing Primer
(F):5'- GCTTGGAGCAGTTTAAAGCCATC -3'
(R):5'- AATCCCCGGAAGAGACTTTG -3'
Genotyping

R1726:Uhrf1bp1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

R1726:Uhrf1bp1 (F): 5’- CCTGTCAGCTTGCTTTGGGGAAAC-3’

R1726:Uhrf1bp1 (R): 5’- AAGAACTCGGTGGCAGCGAATC-3’

 

Sequencing Primers

R1726:Uhrf1bp1 _seq(F): 5’- GCTTGGAGCAGTTTAAAGCCATC-3’
 

R1726:Uhrf1bp1 _seq(R): 5’- AATCCCCGGAAGAGACTTTG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 473 nucleotides is amplified (Chr.17: 27885954-27886426, GRCm38; NC_000083):

 

cctgtcagct tgctttgggg aaacctcttt tgtctagatt tataccgaag cttggagcag       

tttaaagcca tctataagct ggaagcttcg aggggaagag atgagcacgt ggacgtccga      

ctggacgcat tctggttgaa ggtagggcca gagctgggct ttgtcacgtg tggggagaca      

cagctacatc ccctccaagg tggtgagctg tagttctgct gtgtccactt ggcagaagca      

ggaaaattgg cttcagatgc cctgtgcttg ctggcatggc cttaactgtg tctcgctcgc      

tctctgaagg tgagcttccc cctggagacg agagagctgg cgaagctgca tcgcccccag      

gcgctggtcc tctccacgtc ctccatgatt gccaccaata cccggcatgc cccgaactgc      

actcgcccag acctccaaag tctcttccgg ggattcgctg ccaccgagtt ctt

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated C (C>A) is shown in red text.

Posted On2014-05-23