Incidental Mutation 'R1727:Plcg1'
ID198203
Institutional Source Beutler Lab
Gene Symbol Plcg1
Ensembl Gene ENSMUSG00000016933
Gene Namephospholipase C, gamma 1
SynonymsCded, Plc-gamma1, Plcg-1, Plc-1
MMRRC Submission 039759-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1727 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160731300-160775760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160748088 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 142 (E142G)
Ref Sequence ENSEMBL: ENSMUSP00000099404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590] [ENSMUST00000174885]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000017077
Predicted Effect probably benign
Transcript: ENSMUST00000103115
AA Change: E142G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: E142G

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109462
AA Change: E142G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: E142G

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 240 318 5.2e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133937
Predicted Effect probably benign
Transcript: ENSMUST00000151590
AA Change: E142G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933
AA Change: E142G

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 239 318 4.4e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173791
Predicted Effect probably benign
Transcript: ENSMUST00000174885
SMART Domains Protein: ENSMUSP00000134720
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
SCOP:d1mai__ 27 110 2e-16 SMART
Blast:PH 28 110 6e-53 BLAST
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency 96% (98/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,428,964 probably benign Het
Ak2 C T 4: 129,007,763 P159L probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Akr1a1 A G 4: 116,641,051 L99P probably damaging Het
Anxa8 T A 14: 34,089,590 M34K probably damaging Het
Axl T G 7: 25,760,766 D767A possibly damaging Het
B430305J03Rik A G 3: 61,363,878 probably benign Het
Cdh24 A T 14: 54,638,638 Y182* probably null Het
Cdk5rap2 T C 4: 70,272,679 D1043G probably benign Het
Cdk5rap2 A T 4: 70,289,972 S746T possibly damaging Het
Cep120 T C 18: 53,727,729 M210V probably benign Het
Chga C T 12: 102,561,437 H117Y possibly damaging Het
Cnga4 T C 7: 105,405,754 W79R probably damaging Het
Cntnap5b C T 1: 100,213,744 T575I possibly damaging Het
Col6a3 T A 1: 90,796,574 probably null Het
Copz2 T C 11: 96,853,475 V71A probably benign Het
Dennd3 G T 15: 73,565,128 R1068L possibly damaging Het
Dhrs7 T C 12: 72,659,464 T56A probably damaging Het
Dnah17 G A 11: 118,070,489 T2557I probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Eif3b T C 5: 140,425,322 I176T probably damaging Het
Eif4b T A 15: 102,090,062 D392E possibly damaging Het
Eif4h T C 5: 134,639,280 Y7C probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Epg5 T A 18: 78,015,815 V1928E possibly damaging Het
Erbin T A 13: 103,827,968 E1222V probably benign Het
Fam160b2 C A 14: 70,593,998 G32V probably damaging Het
Fhdc1 T A 3: 84,446,176 I581F possibly damaging Het
Fstl4 A C 11: 53,068,651 Q173P probably damaging Het
Gm266 A G 12: 111,485,479 F98L possibly damaging Het
Gsdmc2 T C 15: 63,849,779 probably benign Het
Gtf2h3 A G 5: 124,590,356 Q156R probably benign Het
H2-T23 T C 17: 36,031,653 T198A possibly damaging Het
Il1r1 C A 1: 40,293,264 A68E probably benign Het
Kcna7 A T 7: 45,409,506 I406F possibly damaging Het
Lbr A G 1: 181,819,916 I432T probably benign Het
Lnx1 A T 5: 74,607,916 probably null Het
Lrrcc1 T A 3: 14,537,363 I50N probably damaging Het
Lss T C 10: 76,539,844 V237A possibly damaging Het
Mcm10 A G 2: 5,006,525 F212L probably benign Het
Methig1 A C 15: 100,353,249 I14L probably benign Het
Mrpl41 A T 2: 24,974,624 V55E probably damaging Het
Mtfp1 C A 11: 4,093,982 D83Y probably damaging Het
Myh1 T A 11: 67,210,466 probably benign Het
Myo1e T C 9: 70,376,524 F834S possibly damaging Het
Ndufs7 A T 10: 80,256,019 probably benign Het
Nlrp4e T A 7: 23,320,995 N302K probably benign Het
Nt5e T A 9: 88,328,029 M115K possibly damaging Het
Nup153 A T 13: 46,693,785 C723S probably damaging Het
Obox6 G A 7: 15,834,577 P125S probably benign Het
Olfr1104 A G 2: 87,022,263 F94L probably damaging Het
Olfr235 T G 19: 12,269,001 I257S possibly damaging Het
Olfr330 A T 11: 58,529,516 S157T possibly damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr665 C T 7: 104,881,514 T269I probably benign Het
Pcdh1 A C 18: 38,203,032 Y44* probably null Het
Pcdhb6 A T 18: 37,334,587 D187V probably damaging Het
Pclo A G 5: 14,676,987 probably benign Het
Pdcl3 T A 1: 38,995,755 I80K possibly damaging Het
Pde12 A T 14: 26,668,867 V229E probably benign Het
Plxnb1 A G 9: 109,101,057 probably null Het
Pnpla1 A G 17: 28,878,534 I225V probably benign Het
Polr2f A G 15: 79,144,605 probably benign Het
Prob1 A G 18: 35,654,311 S297P possibly damaging Het
Qsox2 A C 2: 26,220,958 S132A probably benign Het
Rab19 T A 6: 39,388,161 Y118* probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptn T C 3: 93,397,138 S593P possibly damaging Het
Sept11 T C 5: 93,156,924 I200T probably damaging Het
Slc10a4 T A 5: 73,016,148 probably benign Het
Slc9c1 A T 16: 45,601,961 I1130F probably benign Het
Slit3 C T 11: 35,629,832 R599C probably damaging Het
Snx19 C T 9: 30,433,366 P622L probably damaging Het
Sspo T C 6: 48,494,848 L50P probably damaging Het
St8sia1 A T 6: 142,876,727 C137S probably damaging Het
Syt11 G C 3: 88,761,952 T211S possibly damaging Het
Tanc1 A C 2: 59,790,809 Y324S probably damaging Het
Tas2r136 T C 6: 132,777,790 I125V possibly damaging Het
Tbc1d15 A T 10: 115,210,225 W458R probably damaging Het
Tctex1d2 T A 16: 32,422,933 M78K probably benign Het
Tecta G T 9: 42,359,301 T1237N probably damaging Het
Tet2 T A 3: 133,487,290 D461V probably damaging Het
Tmco3 G A 8: 13,318,866 V573M possibly damaging Het
Tmem212 A T 3: 27,884,812 M175K probably benign Het
Traf6 A G 2: 101,696,739 H278R probably benign Het
Trerf1 T A 17: 47,341,166 noncoding transcript Het
Ttn A C 2: 76,746,644 V24635G probably damaging Het
Ush1c A T 7: 46,209,231 D544E probably damaging Het
Usp47 C T 7: 112,086,100 T586M probably damaging Het
Vmn2r1 T A 3: 64,081,742 M34K probably benign Het
Vmn2r102 T A 17: 19,677,508 W262R probably damaging Het
Wasf3 C T 5: 146,466,959 A293V probably benign Het
Xrn2 A G 2: 147,061,516 Q812R probably benign Het
Zc3h7b T C 15: 81,768,029 I10T probably damaging Het
Zfp747 A T 7: 127,374,077 L307Q probably damaging Het
Zfp777 A T 6: 48,043,890 F266Y probably damaging Het
Other mutations in Plcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Plcg1 APN 2 160757266 missense probably damaging 1.00
IGL00885:Plcg1 APN 2 160758083 missense probably benign 0.03
IGL01066:Plcg1 APN 2 160754398 missense probably damaging 1.00
IGL01356:Plcg1 APN 2 160753893 missense probably damaging 1.00
IGL01629:Plcg1 APN 2 160758010 missense possibly damaging 0.69
IGL01732:Plcg1 APN 2 160747779 missense probably damaging 0.97
IGL01754:Plcg1 APN 2 160761433 missense probably damaging 1.00
IGL02195:Plcg1 APN 2 160753926 missense possibly damaging 0.83
IGL02371:Plcg1 APN 2 160753507 missense probably damaging 0.99
IGL02671:Plcg1 APN 2 160755752 nonsense probably null
IGL03096:Plcg1 APN 2 160757206 splice site probably benign
IGL03129:Plcg1 APN 2 160774526 critical splice acceptor site probably null
IGL03139:Plcg1 APN 2 160748129 critical splice donor site probably null
IGL03211:Plcg1 APN 2 160759691 missense possibly damaging 0.82
suscepit UTSW 2 160753602 intron probably null
IGL03047:Plcg1 UTSW 2 160754879 missense probably damaging 1.00
R0098:Plcg1 UTSW 2 160732000 missense probably damaging 1.00
R0390:Plcg1 UTSW 2 160752366 missense probably damaging 1.00
R0413:Plcg1 UTSW 2 160761429 missense probably damaging 1.00
R0650:Plcg1 UTSW 2 160753363 splice site probably benign
R0679:Plcg1 UTSW 2 160756910 missense probably damaging 1.00
R0709:Plcg1 UTSW 2 160751778 splice site probably null
R1719:Plcg1 UTSW 2 160753743 missense probably null 0.94
R1721:Plcg1 UTSW 2 160731920 missense probably damaging 0.99
R1978:Plcg1 UTSW 2 160752578 unclassified probably null
R2277:Plcg1 UTSW 2 160755805 missense possibly damaging 0.48
R2698:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R3832:Plcg1 UTSW 2 160754437 missense possibly damaging 0.95
R4094:Plcg1 UTSW 2 160747841 missense probably damaging 0.98
R4260:Plcg1 UTSW 2 160751707 critical splice donor site probably null
R4622:Plcg1 UTSW 2 160747768 splice site probably benign
R4837:Plcg1 UTSW 2 160750986 missense probably benign 0.00
R4942:Plcg1 UTSW 2 160753589 intron probably null
R5514:Plcg1 UTSW 2 160753355 critical splice donor site probably null
R5647:Plcg1 UTSW 2 160751668 missense probably benign 0.45
R5929:Plcg1 UTSW 2 160753602 intron probably null
R6303:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6304:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6471:Plcg1 UTSW 2 160753710 missense probably benign 0.10
R6500:Plcg1 UTSW 2 160754567 missense probably damaging 1.00
R7017:Plcg1 UTSW 2 160758097 missense probably damaging 1.00
R7113:Plcg1 UTSW 2 160748283 missense possibly damaging 0.78
R7137:Plcg1 UTSW 2 160753926 missense possibly damaging 0.83
R7155:Plcg1 UTSW 2 160754380 missense probably damaging 1.00
R7211:Plcg1 UTSW 2 160731874 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGACTTTGACCGCTACCAAGAAGAC -3'
(R):5'- GCCTCTTCTCAGCTAAGGTAAAGCC -3'

Sequencing Primer
(F):5'- ATTCCGCTTGAAGACCCTGAG -3'
(R):5'- CCTGGGTAGAAGAGAAGTTACCG -3'
Posted On2014-05-23