Incidental Mutation 'R1727:Slit3'
ID198252
Institutional Source Beutler Lab
Gene Symbol Slit3
Ensembl Gene ENSMUSG00000056427
Gene Nameslit guidance ligand 3
SynonymsSlit1
MMRRC Submission 039759-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R1727 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location35121224-35708507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35629832 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 599 (R599C)
Ref Sequence ENSEMBL: ENSMUSP00000066857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069837]
Predicted Effect probably damaging
Transcript: ENSMUST00000069837
AA Change: R599C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: R599C

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
LRRNT 33 65 2.12e-8 SMART
LRR 59 83 1.37e2 SMART
LRR_TYP 84 107 1.12e-3 SMART
LRR_TYP 108 131 7.78e-3 SMART
LRR_TYP 132 155 5.42e-2 SMART
LRR 156 179 5.88e0 SMART
LRR 180 203 7.55e-1 SMART
LRRCT 215 264 1.33e-6 SMART
LRRNT 279 311 6.79e-7 SMART
LRR 305 329 1.16e2 SMART
LRR 330 353 1.26e1 SMART
LRR_TYP 354 377 2.79e-4 SMART
LRR 378 401 4.05e-1 SMART
LRR 402 425 4.05e-1 SMART
LRRCT 437 486 7.75e-8 SMART
LRRNT 504 536 1.95e-7 SMART
LRR_TYP 556 579 7.49e-5 SMART
LRR 581 603 6.41e1 SMART
LRR_TYP 604 627 2.53e-2 SMART
LRR 628 651 1.76e-1 SMART
LRRCT 663 712 2.52e-7 SMART
LRRNT 724 756 3e-8 SMART
LRR 774 797 2.14e0 SMART
LRR_TYP 798 821 2.95e-3 SMART
LRR_TYP 822 845 2.43e-4 SMART
LRRCT 857 906 1.12e-13 SMART
EGF 919 953 6.86e-4 SMART
EGF 958 994 8.84e-7 SMART
EGF 999 1032 1.13e-4 SMART
EGF 1037 1072 2.3e-5 SMART
EGF_CA 1074 1110 5.92e-8 SMART
EGF 1122 1155 3.79e-6 SMART
LamG 1178 1314 3.16e-34 SMART
EGF 1331 1365 2.19e-2 SMART
EGF 1371 1403 1.13e-4 SMART
EGF 1411 1444 5.57e-4 SMART
CT 1455 1523 4.56e-5 SMART
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency 96% (98/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,428,964 probably benign Het
Ak2 C T 4: 129,007,763 P159L probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Akr1a1 A G 4: 116,641,051 L99P probably damaging Het
Anxa8 T A 14: 34,089,590 M34K probably damaging Het
Axl T G 7: 25,760,766 D767A possibly damaging Het
B430305J03Rik A G 3: 61,363,878 probably benign Het
Cdh24 A T 14: 54,638,638 Y182* probably null Het
Cdk5rap2 T C 4: 70,272,679 D1043G probably benign Het
Cdk5rap2 A T 4: 70,289,972 S746T possibly damaging Het
Cep120 T C 18: 53,727,729 M210V probably benign Het
Chga C T 12: 102,561,437 H117Y possibly damaging Het
Cnga4 T C 7: 105,405,754 W79R probably damaging Het
Cntnap5b C T 1: 100,213,744 T575I possibly damaging Het
Col6a3 T A 1: 90,796,574 probably null Het
Copz2 T C 11: 96,853,475 V71A probably benign Het
Dennd3 G T 15: 73,565,128 R1068L possibly damaging Het
Dhrs7 T C 12: 72,659,464 T56A probably damaging Het
Dnah17 G A 11: 118,070,489 T2557I probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Eif3b T C 5: 140,425,322 I176T probably damaging Het
Eif4b T A 15: 102,090,062 D392E possibly damaging Het
Eif4h T C 5: 134,639,280 Y7C probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Epg5 T A 18: 78,015,815 V1928E possibly damaging Het
Erbin T A 13: 103,827,968 E1222V probably benign Het
Fam160b2 C A 14: 70,593,998 G32V probably damaging Het
Fhdc1 T A 3: 84,446,176 I581F possibly damaging Het
Fstl4 A C 11: 53,068,651 Q173P probably damaging Het
Gm266 A G 12: 111,485,479 F98L possibly damaging Het
Gsdmc2 T C 15: 63,849,779 probably benign Het
Gtf2h3 A G 5: 124,590,356 Q156R probably benign Het
H2-T23 T C 17: 36,031,653 T198A possibly damaging Het
Il1r1 C A 1: 40,293,264 A68E probably benign Het
Kcna7 A T 7: 45,409,506 I406F possibly damaging Het
Lbr A G 1: 181,819,916 I432T probably benign Het
Lnx1 A T 5: 74,607,916 probably null Het
Lrrcc1 T A 3: 14,537,363 I50N probably damaging Het
Lss T C 10: 76,539,844 V237A possibly damaging Het
Mcm10 A G 2: 5,006,525 F212L probably benign Het
Methig1 A C 15: 100,353,249 I14L probably benign Het
Mrpl41 A T 2: 24,974,624 V55E probably damaging Het
Mtfp1 C A 11: 4,093,982 D83Y probably damaging Het
Myh1 T A 11: 67,210,466 probably benign Het
Myo1e T C 9: 70,376,524 F834S possibly damaging Het
Ndufs7 A T 10: 80,256,019 probably benign Het
Nlrp4e T A 7: 23,320,995 N302K probably benign Het
Nt5e T A 9: 88,328,029 M115K possibly damaging Het
Nup153 A T 13: 46,693,785 C723S probably damaging Het
Obox6 G A 7: 15,834,577 P125S probably benign Het
Olfr1104 A G 2: 87,022,263 F94L probably damaging Het
Olfr235 T G 19: 12,269,001 I257S possibly damaging Het
Olfr330 A T 11: 58,529,516 S157T possibly damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr665 C T 7: 104,881,514 T269I probably benign Het
Pcdh1 A C 18: 38,203,032 Y44* probably null Het
Pcdhb6 A T 18: 37,334,587 D187V probably damaging Het
Pclo A G 5: 14,676,987 probably benign Het
Pdcl3 T A 1: 38,995,755 I80K possibly damaging Het
Pde12 A T 14: 26,668,867 V229E probably benign Het
Plcg1 A G 2: 160,748,088 E142G probably benign Het
Plxnb1 A G 9: 109,101,057 probably null Het
Pnpla1 A G 17: 28,878,534 I225V probably benign Het
Polr2f A G 15: 79,144,605 probably benign Het
Prob1 A G 18: 35,654,311 S297P possibly damaging Het
Qsox2 A C 2: 26,220,958 S132A probably benign Het
Rab19 T A 6: 39,388,161 Y118* probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptn T C 3: 93,397,138 S593P possibly damaging Het
Sept11 T C 5: 93,156,924 I200T probably damaging Het
Slc10a4 T A 5: 73,016,148 probably benign Het
Slc9c1 A T 16: 45,601,961 I1130F probably benign Het
Snx19 C T 9: 30,433,366 P622L probably damaging Het
Sspo T C 6: 48,494,848 L50P probably damaging Het
St8sia1 A T 6: 142,876,727 C137S probably damaging Het
Syt11 G C 3: 88,761,952 T211S possibly damaging Het
Tanc1 A C 2: 59,790,809 Y324S probably damaging Het
Tas2r136 T C 6: 132,777,790 I125V possibly damaging Het
Tbc1d15 A T 10: 115,210,225 W458R probably damaging Het
Tctex1d2 T A 16: 32,422,933 M78K probably benign Het
Tecta G T 9: 42,359,301 T1237N probably damaging Het
Tet2 T A 3: 133,487,290 D461V probably damaging Het
Tmco3 G A 8: 13,318,866 V573M possibly damaging Het
Tmem212 A T 3: 27,884,812 M175K probably benign Het
Traf6 A G 2: 101,696,739 H278R probably benign Het
Trerf1 T A 17: 47,341,166 noncoding transcript Het
Ttn A C 2: 76,746,644 V24635G probably damaging Het
Ush1c A T 7: 46,209,231 D544E probably damaging Het
Usp47 C T 7: 112,086,100 T586M probably damaging Het
Vmn2r1 T A 3: 64,081,742 M34K probably benign Het
Vmn2r102 T A 17: 19,677,508 W262R probably damaging Het
Wasf3 C T 5: 146,466,959 A293V probably benign Het
Xrn2 A G 2: 147,061,516 Q812R probably benign Het
Zc3h7b T C 15: 81,768,029 I10T probably damaging Het
Zfp747 A T 7: 127,374,077 L307Q probably damaging Het
Zfp777 A T 6: 48,043,890 F266Y probably damaging Het
Other mutations in Slit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Slit3 APN 11 35622154 missense probably damaging 1.00
IGL01324:Slit3 APN 11 35610702 missense probably damaging 1.00
IGL01612:Slit3 APN 11 35700384 missense possibly damaging 0.95
IGL02145:Slit3 APN 11 35629742 missense probably damaging 0.99
IGL02146:Slit3 APN 11 35234848 missense possibly damaging 0.71
IGL02430:Slit3 APN 11 35177774 splice site probably null
IGL02528:Slit3 APN 11 35578974 missense probably benign
IGL02530:Slit3 APN 11 35708142 makesense probably null
IGL02640:Slit3 APN 11 35700345 missense probably benign 0.10
IGL02819:Slit3 APN 11 35171590 missense possibly damaging 0.71
IGL02839:Slit3 APN 11 35649047 missense possibly damaging 0.46
IGL03150:Slit3 APN 11 35508257 missense possibly damaging 0.88
IGL03161:Slit3 APN 11 35700414 missense probably benign 0.10
IGL03336:Slit3 APN 11 35670101 missense probably damaging 0.97
IGL02988:Slit3 UTSW 11 35708063 missense probably damaging 0.99
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0334:Slit3 UTSW 11 35579101 missense probably damaging 0.97
R0385:Slit3 UTSW 11 35700282 missense probably damaging 0.98
R0840:Slit3 UTSW 11 35623436 splice site probably benign
R1065:Slit3 UTSW 11 35121635 missense possibly damaging 0.86
R1364:Slit3 UTSW 11 35670107 missense probably benign
R1476:Slit3 UTSW 11 35686299 missense probably damaging 0.97
R1508:Slit3 UTSW 11 35570621 missense probably damaging 1.00
R1665:Slit3 UTSW 11 35234906 missense possibly damaging 0.71
R1692:Slit3 UTSW 11 35659344 missense probably damaging 1.00
R1696:Slit3 UTSW 11 35675923 missense probably damaging 0.99
R1752:Slit3 UTSW 11 35564653 missense probably damaging 0.98
R1970:Slit3 UTSW 11 35630841 critical splice acceptor site probably null
R2077:Slit3 UTSW 11 35544748 missense possibly damaging 0.88
R2126:Slit3 UTSW 11 35688679 missense probably damaging 1.00
R2143:Slit3 UTSW 11 35612261 splice site probably null
R2162:Slit3 UTSW 11 35688682 missense probably null 1.00
R2873:Slit3 UTSW 11 35544793 nonsense probably null
R3813:Slit3 UTSW 11 35675979 missense probably damaging 1.00
R3831:Slit3 UTSW 11 35688682 missense probably null 1.00
R3832:Slit3 UTSW 11 35688682 missense probably null 1.00
R3833:Slit3 UTSW 11 35688682 missense probably null 1.00
R3839:Slit3 UTSW 11 35508237 missense probably benign 0.10
R4152:Slit3 UTSW 11 35698320 missense probably damaging 0.98
R4387:Slit3 UTSW 11 35684048 missense probably benign 0.12
R4795:Slit3 UTSW 11 35651820 critical splice donor site probably null
R4910:Slit3 UTSW 11 35632722 missense probably damaging 0.99
R4933:Slit3 UTSW 11 35688593 missense probably damaging 1.00
R5048:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5106:Slit3 UTSW 11 35612367 missense probably damaging 1.00
R5138:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5218:Slit3 UTSW 11 35684175 critical splice donor site probably null
R5338:Slit3 UTSW 11 35622148 missense probably benign
R5354:Slit3 UTSW 11 35675913 missense probably damaging 1.00
R5436:Slit3 UTSW 11 35707911 missense probably benign 0.05
R5896:Slit3 UTSW 11 35708105 missense probably damaging 0.99
R5933:Slit3 UTSW 11 35629751 missense probably benign 0.04
R5963:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R5964:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R6125:Slit3 UTSW 11 35570733 critical splice donor site probably null
R6153:Slit3 UTSW 11 35700483 missense possibly damaging 0.69
R6484:Slit3 UTSW 11 35661298 missense probably benign
R6526:Slit3 UTSW 11 35661292 missense probably benign 0.33
R6797:Slit3 UTSW 11 35633952 missense possibly damaging 0.55
X0028:Slit3 UTSW 11 35564637 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCTGCTGTGAGAAGTGACCTTG -3'
(R):5'- TGCTTGAACGTAGATGCTCGCC -3'

Sequencing Primer
(F):5'- CAAGCTGAGACTCCAGTGTC -3'
(R):5'- AACGTAGATGCTCGCCTTCAG -3'
Posted On2014-05-23