Incidental Mutation 'R0084:Osbpl1a'
ID19830
Institutional Source Beutler Lab
Gene Symbol Osbpl1a
Ensembl Gene ENSMUSG00000044252
Gene Nameoxysterol binding protein-like 1A
SynonymsLOC328902, G430090F17Rik
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R0084 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12755314-12941841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12757612 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 524 (T524A)
Ref Sequence ENSEMBL: ENSMUSP00000113914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000080415] [ENSMUST00000115857] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119108] [ENSMUST00000119512] [ENSMUST00000121018] [ENSMUST00000121774] [ENSMUST00000121808] [ENSMUST00000121888] [ENSMUST00000150758] [ENSMUST00000186263] [ENSMUST00000191078]
Predicted Effect probably benign
Transcript: ENSMUST00000074352
AA Change: T916A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252
AA Change: T916A

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080415
SMART Domains Protein: ENSMUSP00000079277
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115857
SMART Domains Protein: ENSMUSP00000111523
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.2e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117361
AA Change: T403A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252
AA Change: T403A

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118313
AA Change: T403A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252
AA Change: T403A

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119043
AA Change: T403A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252
AA Change: T403A

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119108
SMART Domains Protein: ENSMUSP00000113760
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 8.5e-13 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119512
AA Change: T524A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113914
Gene: ENSMUSG00000044252
AA Change: T524A

DomainStartEndE-ValueType
coiled coil region 38 71 N/A INTRINSIC
Pfam:Oxysterol_BP 156 549 1.2e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121018
SMART Domains Protein: ENSMUSP00000113131
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 6.7e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121774
AA Change: T376A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252
AA Change: T376A

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121808
AA Change: T403A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252
AA Change: T403A

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121888
AA Change: T403A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252
AA Change: T403A

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145777
Predicted Effect probably benign
Transcript: ENSMUST00000150758
SMART Domains Protein: ENSMUSP00000118330
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186263
SMART Domains Protein: ENSMUSP00000140870
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191078
SMART Domains Protein: ENSMUSP00000140894
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. Transcript variants derived from alternative promoter usage and/or alternative splicing exist; they encode different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Osbpl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Osbpl1a APN 18 12757626 missense possibly damaging 0.51
IGL01062:Osbpl1a APN 18 12905075 missense probably benign
IGL01450:Osbpl1a APN 18 12871095 missense possibly damaging 0.88
IGL01531:Osbpl1a APN 18 12933581 missense probably damaging 1.00
IGL01548:Osbpl1a APN 18 12763575 missense probably damaging 1.00
IGL01606:Osbpl1a APN 18 12756214 missense possibly damaging 0.79
IGL01672:Osbpl1a APN 18 12766824 missense probably damaging 1.00
IGL02372:Osbpl1a APN 18 12841313 nonsense probably null
IGL02451:Osbpl1a APN 18 12914493 splice site probably benign
IGL02490:Osbpl1a APN 18 12882284 unclassified probably benign
IGL02884:Osbpl1a APN 18 12819578 nonsense probably null
R0266:Osbpl1a UTSW 18 12871163 unclassified probably null
R0565:Osbpl1a UTSW 18 12759444 missense probably damaging 1.00
R0605:Osbpl1a UTSW 18 12882279 critical splice acceptor site probably null
R0899:Osbpl1a UTSW 18 12757690 missense possibly damaging 0.70
R1330:Osbpl1a UTSW 18 12882194 critical splice donor site probably null
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1475:Osbpl1a UTSW 18 12757680 missense probably damaging 1.00
R1495:Osbpl1a UTSW 18 12758839 missense probably benign 0.08
R1734:Osbpl1a UTSW 18 12788316 splice site probably null
R1930:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R1931:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R2109:Osbpl1a UTSW 18 12759400 missense probably damaging 1.00
R2144:Osbpl1a UTSW 18 12871173 missense probably benign 0.06
R2504:Osbpl1a UTSW 18 12905031 missense probably benign 0.30
R2762:Osbpl1a UTSW 18 12766899 missense possibly damaging 0.83
R2907:Osbpl1a UTSW 18 12871072 unclassified probably benign
R4306:Osbpl1a UTSW 18 12819595 missense probably benign
R4835:Osbpl1a UTSW 18 12768536 critical splice donor site probably null
R5097:Osbpl1a UTSW 18 12763537 missense probably damaging 1.00
R5173:Osbpl1a UTSW 18 12762640 missense probably benign 0.12
R5224:Osbpl1a UTSW 18 12933696 missense probably benign 0.01
R5245:Osbpl1a UTSW 18 12758853 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12841192 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12892262 missense probably benign 0.22
R5833:Osbpl1a UTSW 18 12788362 missense probably damaging 1.00
R5986:Osbpl1a UTSW 18 12905081 missense probably damaging 1.00
R6267:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6296:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6477:Osbpl1a UTSW 18 12756261 missense probably benign 0.03
R6997:Osbpl1a UTSW 18 12756224 missense probably benign 0.05
R7105:Osbpl1a UTSW 18 12766963 missense probably benign 0.17
R7107:Osbpl1a UTSW 18 12841253 nonsense probably null
R7154:Osbpl1a UTSW 18 12768592 missense probably benign 0.00
X0027:Osbpl1a UTSW 18 12759503 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGCAATCATAGCAGCCATCTGCC -3'
(R):5'- GTTACTGCTCTTAGTGCCATGCCTG -3'

Sequencing Primer
(F):5'- TAACCCCTGCGTTTGGAAAAG -3'
(R):5'- CGAATGTGTTTCCCATTGGC -3'
Posted On2013-04-11