Incidental Mutation 'R0085:Lig1'
ID19852
Institutional Source Beutler Lab
Gene Symbol Lig1
Ensembl Gene ENSMUSG00000056394
Gene Nameligase I, DNA, ATP-dependent
SynonymsLigI, mLigI
MMRRC Submission 038372-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0085 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13277283-13311433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13307570 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 776 (I776V)
Ref Sequence ENSEMBL: ENSMUSP00000136972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098814] [ENSMUST00000165964] [ENSMUST00000177588]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098814
AA Change: I776V

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096411
Gene: ENSMUSG00000056394
AA Change: I776V

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123846
SMART Domains Protein: ENSMUSP00000119788
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147735
SMART Domains Protein: ENSMUSP00000115286
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148471
SMART Domains Protein: ENSMUSP00000114153
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156525
SMART Domains Protein: ENSMUSP00000118055
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165964
AA Change: I776V

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126525
Gene: ENSMUSG00000056394
AA Change: I776V

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 302 478 1.7e-40 PFAM
Pfam:DNA_ligase_A_M 556 760 1.1e-69 PFAM
Pfam:DNA_ligase_A_C 785 896 1.6e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177588
AA Change: I776V

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136972
Gene: ENSMUSG00000056394
AA Change: I776V

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-dependent DNA ligase protein family. The encoded protein functions in DNA replication, recombination, and the base excision repair process. Mutations in this gene that lead to DNA ligase I deficiency result in immunodeficiency and increased sensitivity to DNA-damaging agents. Disruption of this gene may also be associated with a variety of cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired fetal hematopoiesis, develop anemia, and die by E16.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,711,739 S583R probably damaging Het
Acad12 A G 5: 121,604,294 I417T possibly damaging Het
Adcy9 T C 16: 4,288,224 T1009A probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baat T C 4: 49,490,425 probably benign Het
Bpi T A 2: 158,273,152 L311* probably null Het
Brd2 A C 17: 34,113,259 F294L probably damaging Het
Carmil1 T A 13: 24,025,867 E804D probably benign Het
Cd209g A T 8: 4,134,785 probably benign Het
Cfi A G 3: 129,874,986 I554V probably benign Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Dst T C 1: 34,229,187 S2897P probably damaging Het
Efcab7 T C 4: 99,904,680 probably benign Het
Fbxo2 T C 4: 148,164,910 probably null Het
Fgfr2 C A 7: 130,196,263 R400L probably damaging Het
Hsd17b14 T C 7: 45,556,410 probably benign Het
Il23r T C 6: 67,486,222 N96D probably damaging Het
Ints13 T A 6: 146,574,787 probably benign Het
Madd T C 2: 91,162,738 I997V probably benign Het
Mgat4b C T 11: 50,230,999 H116Y possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo5b A C 18: 74,701,680 D937A probably benign Het
Nox3 T C 17: 3,635,281 N584S probably benign Het
Ogfr A G 2: 180,591,037 probably null Het
Olfr1341 T C 4: 118,709,881 V158A probably benign Het
Olfr741 T A 14: 50,486,334 M292K probably benign Het
Olfr904 T C 9: 38,464,662 I207T probably benign Het
Osbpl6 G T 2: 76,593,414 V728F probably benign Het
Picalm T A 7: 90,182,317 S453T probably benign Het
Piezo1 A G 8: 122,501,615 L310P probably damaging Het
Pitrm1 C T 13: 6,549,568 probably benign Het
Pkd1 T C 17: 24,586,223 F3250L probably damaging Het
Plekha4 C T 7: 45,543,949 R376* probably null Het
Pnmal2 A T 7: 16,945,549 S153C unknown Het
Rp1l1 C T 14: 64,022,295 R129W probably damaging Het
Ryr3 A G 2: 112,859,763 V1147A probably damaging Het
Sema3d G A 5: 12,570,986 V520I probably benign Het
Sgsm1 A G 5: 113,279,270 probably benign Het
Slc13a2 A G 11: 78,406,868 V58A probably damaging Het
Slc1a4 A G 11: 20,304,510 probably benign Het
Slc4a10 G A 2: 62,244,346 probably benign Het
Tab1 G T 15: 80,155,893 A305S probably benign Het
Tmem30a T A 9: 79,771,294 T327S probably benign Het
Tpr A C 1: 150,417,413 E863A possibly damaging Het
Upk3bl A G 5: 136,060,115 N161D probably benign Het
Ush1c T A 7: 46,225,555 I131F probably damaging Het
Wdfy4 C A 14: 33,078,243 R1975S possibly damaging Het
Zbtb18 C T 1: 177,447,935 A287V probably benign Het
Zfp712 T C 13: 67,041,192 T424A probably benign Het
Zfp791 G T 8: 85,112,233 Y56* probably null Het
Other mutations in Lig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Lig1 APN 7 13301452 nonsense probably null
IGL00499:Lig1 APN 7 13298830 critical splice donor site probably null
IGL01465:Lig1 APN 7 13296391 missense probably benign 0.19
IGL01804:Lig1 APN 7 13309206 missense probably benign 0.43
IGL02068:Lig1 APN 7 13292451 splice site probably benign
IGL02955:Lig1 APN 7 13296347 missense probably damaging 0.99
IGL03188:Lig1 APN 7 13311107 splice site probably benign
IGL03327:Lig1 APN 7 13303855 missense probably damaging 1.00
IGL03411:Lig1 APN 7 13296768 missense probably damaging 1.00
PIT4142001:Lig1 UTSW 7 13305924 frame shift probably null
R0348:Lig1 UTSW 7 13309197 missense probably damaging 1.00
R0362:Lig1 UTSW 7 13296804 unclassified probably benign
R0787:Lig1 UTSW 7 13299069 missense probably benign 0.41
R1170:Lig1 UTSW 7 13292153 missense probably benign 0.00
R1371:Lig1 UTSW 7 13288685 missense probably damaging 1.00
R1610:Lig1 UTSW 7 13285340 missense probably damaging 1.00
R1809:Lig1 UTSW 7 13300355 splice site probably benign
R1986:Lig1 UTSW 7 13309142 nonsense probably null
R2106:Lig1 UTSW 7 13305938 missense probably damaging 1.00
R2343:Lig1 UTSW 7 13292195 unclassified probably null
R2380:Lig1 UTSW 7 13303796 splice site probably benign
R3545:Lig1 UTSW 7 13292163 missense possibly damaging 0.82
R4669:Lig1 UTSW 7 13311028 missense probably damaging 1.00
R4928:Lig1 UTSW 7 13298738 missense probably damaging 1.00
R5167:Lig1 UTSW 7 13311058 missense probably damaging 0.97
R5249:Lig1 UTSW 7 13308507 missense possibly damaging 0.60
R5351:Lig1 UTSW 7 13300949 missense probably damaging 1.00
R5373:Lig1 UTSW 7 13305923 frame shift probably null
R5607:Lig1 UTSW 7 13306008 missense probably damaging 0.97
R5608:Lig1 UTSW 7 13306008 missense probably damaging 0.97
R5620:Lig1 UTSW 7 13286606 missense possibly damaging 0.66
R5799:Lig1 UTSW 7 13296258 missense possibly damaging 0.67
R6057:Lig1 UTSW 7 13288672 missense probably damaging 0.99
R6897:Lig1 UTSW 7 13305914 missense probably damaging 1.00
X0020:Lig1 UTSW 7 13296774 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AAGGTGATGCTCCTCACACACCTC -3'
(R):5'- GGCAGCTACCTGCAACTGCTTATG -3'

Sequencing Primer
(F):5'- ACACACCTCCAGCTCATTTG -3'
(R):5'- TCAGAGTTGATTGAACAcatgc -3'
Posted On2013-04-11