Incidental Mutation 'R0085:Plekha4'
ID19854
Institutional Source Beutler Lab
Gene Symbol Plekha4
Ensembl Gene ENSMUSG00000040428
Gene Namepleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms2410005C22Rik, PEPP1
MMRRC Submission 038372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R0085 (G1)
Quality Score221
Status Validated
Chromosome7
Chromosomal Location45526330-45554229 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 45543949 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 376 (R376*)
Ref Sequence ENSEMBL: ENSMUSP00000147344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051810] [ENSMUST00000209517] [ENSMUST00000211155] [ENSMUST00000211227] [ENSMUST00000211797]
Predicted Effect probably null
Transcript: ENSMUST00000051810
AA Change: R447*
SMART Domains Protein: ENSMUSP00000051468
Gene: ENSMUSG00000040428
AA Change: R447*

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121932
AA Change: R447*
SMART Domains Protein: ENSMUSP00000113802
Gene: ENSMUSG00000040428
AA Change: R447*

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209517
AA Change: R447*
Predicted Effect probably null
Transcript: ENSMUST00000211155
AA Change: R419*
Predicted Effect probably null
Transcript: ENSMUST00000211227
AA Change: R447*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211794
Predicted Effect probably null
Transcript: ENSMUST00000211797
AA Change: R376*
Meta Mutation Damage Score 0.626 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 95% (71/75)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,711,739 S583R probably damaging Het
Acad12 A G 5: 121,604,294 I417T possibly damaging Het
Adcy9 T C 16: 4,288,224 T1009A probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baat T C 4: 49,490,425 probably benign Het
Bpi T A 2: 158,273,152 L311* probably null Het
Brd2 A C 17: 34,113,259 F294L probably damaging Het
Carmil1 T A 13: 24,025,867 E804D probably benign Het
Cd209g A T 8: 4,134,785 probably benign Het
Cfi A G 3: 129,874,986 I554V probably benign Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Dst T C 1: 34,229,187 S2897P probably damaging Het
Efcab7 T C 4: 99,904,680 probably benign Het
Fbxo2 T C 4: 148,164,910 probably null Het
Fgfr2 C A 7: 130,196,263 R400L probably damaging Het
Hsd17b14 T C 7: 45,556,410 probably benign Het
Il23r T C 6: 67,486,222 N96D probably damaging Het
Ints13 T A 6: 146,574,787 probably benign Het
Lig1 A G 7: 13,307,570 I776V possibly damaging Het
Madd T C 2: 91,162,738 I997V probably benign Het
Mgat4b C T 11: 50,230,999 H116Y possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo5b A C 18: 74,701,680 D937A probably benign Het
Nox3 T C 17: 3,635,281 N584S probably benign Het
Ogfr A G 2: 180,591,037 probably null Het
Olfr1341 T C 4: 118,709,881 V158A probably benign Het
Olfr741 T A 14: 50,486,334 M292K probably benign Het
Olfr904 T C 9: 38,464,662 I207T probably benign Het
Osbpl6 G T 2: 76,593,414 V728F probably benign Het
Picalm T A 7: 90,182,317 S453T probably benign Het
Piezo1 A G 8: 122,501,615 L310P probably damaging Het
Pitrm1 C T 13: 6,549,568 probably benign Het
Pkd1 T C 17: 24,586,223 F3250L probably damaging Het
Pnmal2 A T 7: 16,945,549 S153C unknown Het
Rp1l1 C T 14: 64,022,295 R129W probably damaging Het
Ryr3 A G 2: 112,859,763 V1147A probably damaging Het
Sema3d G A 5: 12,570,986 V520I probably benign Het
Sgsm1 A G 5: 113,279,270 probably benign Het
Slc13a2 A G 11: 78,406,868 V58A probably damaging Het
Slc1a4 A G 11: 20,304,510 probably benign Het
Slc4a10 G A 2: 62,244,346 probably benign Het
Tab1 G T 15: 80,155,893 A305S probably benign Het
Tmem30a T A 9: 79,771,294 T327S probably benign Het
Tpr A C 1: 150,417,413 E863A possibly damaging Het
Upk3bl A G 5: 136,060,115 N161D probably benign Het
Ush1c T A 7: 46,225,555 I131F probably damaging Het
Wdfy4 C A 14: 33,078,243 R1975S possibly damaging Het
Zbtb18 C T 1: 177,447,935 A287V probably benign Het
Zfp712 T C 13: 67,041,192 T424A probably benign Het
Zfp791 G T 8: 85,112,233 Y56* probably null Het
Other mutations in Plekha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Plekha4 APN 7 45538235 missense probably damaging 0.97
IGL01716:Plekha4 APN 7 45534343 missense probably damaging 0.98
IGL02072:Plekha4 APN 7 45538298 missense probably benign 0.29
IGL02815:Plekha4 APN 7 45538412 missense probably damaging 1.00
IGL02939:Plekha4 APN 7 45532363 nonsense probably null
R0239:Plekha4 UTSW 7 45532358 missense probably damaging 1.00
R0239:Plekha4 UTSW 7 45532358 missense probably damaging 1.00
R1036:Plekha4 UTSW 7 45549976 splice site probably benign
R1955:Plekha4 UTSW 7 45553906 missense probably damaging 0.99
R2049:Plekha4 UTSW 7 45553798 missense probably benign 0.01
R2187:Plekha4 UTSW 7 45549274 missense probably damaging 0.99
R2888:Plekha4 UTSW 7 45538244 missense probably damaging 1.00
R5086:Plekha4 UTSW 7 45553658 missense possibly damaging 0.82
R5357:Plekha4 UTSW 7 45534771 missense probably damaging 1.00
R5604:Plekha4 UTSW 7 45549156 missense probably damaging 0.96
R5611:Plekha4 UTSW 7 45553641 missense probably benign
R6255:Plekha4 UTSW 7 45553802 utr 3 prime probably benign
R6341:Plekha4 UTSW 7 45541148 missense probably damaging 1.00
R6502:Plekha4 UTSW 7 45530576 start codon destroyed probably null 0.87
R6720:Plekha4 UTSW 7 45540886 missense possibly damaging 0.86
R6776:Plekha4 UTSW 7 45534817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCAGTCCATGTCCACATGTAG -3'
(R):5'- TGCAACCTAACGTAACACGTTTCCC -3'

Sequencing Primer
(F):5'- GTCCACATGTAGCATATGGACTG -3'
(R):5'- GTTTCCTATCAAGTCACAGCAAG -3'
Posted On2013-04-11