Incidental Mutation 'R1728:Patj'
ID198548
Institutional Source Beutler Lab
Gene Symbol Patj
Ensembl Gene ENSMUSG00000061859
Gene NamePATJ, crumbs cell polarity complex component
SynonymsInadl, Cipp
MMRRC Submission 039760-MU
Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R1728 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location98395785-98719603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98431780 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 428 (G428D)
Ref Sequence ENSEMBL: ENSMUSP00000102649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041284] [ENSMUST00000107030] [ENSMUST00000107033] [ENSMUST00000107034]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041284
AA Change: G428D

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: G428D

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 570 641 1.28e-12 SMART
PDZ 696 775 9.5e-16 SMART
low complexity region 980 991 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
PDZ 1083 1166 8.65e-19 SMART
PDZ 1253 1328 6.12e-19 SMART
low complexity region 1356 1366 N/A INTRINSIC
low complexity region 1410 1428 N/A INTRINSIC
PDZ 1480 1555 4.36e-24 SMART
PDZ 1577 1650 2.49e-19 SMART
PDZ 1718 1795 2.13e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107030
AA Change: G428D

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102645
Gene: ENSMUSG00000061859
AA Change: G428D

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107033
AA Change: G428D

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102648
Gene: ENSMUSG00000061859
AA Change: G428D

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
low complexity region 648 659 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
PDZ 751 834 8.65e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107034
AA Change: G428D

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102649
Gene: ENSMUSG00000061859
AA Change: G428D

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 566 637 1.28e-12 SMART
PDZ 692 771 9.5e-16 SMART
low complexity region 976 987 N/A INTRINSIC
low complexity region 1050 1058 N/A INTRINSIC
PDZ 1079 1162 8.65e-19 SMART
PDZ 1249 1324 6.12e-19 SMART
low complexity region 1352 1362 N/A INTRINSIC
low complexity region 1382 1400 N/A INTRINSIC
PDZ 1452 1499 7.78e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136675
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 223 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,439,600 probably benign Het
Aadat A G 8: 60,526,712 T203A probably damaging Het
Abca13 T A 11: 9,249,680 F104L probably benign Het
Acox1 T A 11: 116,198,283 probably null Het
Adamts17 C T 7: 67,149,956 R1060* probably null Het
Adgrg6 T C 10: 14,439,782 T593A probably damaging Het
Ankrd12 G T 17: 65,984,076 P1454Q probably benign Het
Ap2m1 T A 16: 20,539,338 N35K probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Atr G A 9: 95,897,581 V1331I probably benign Het
Bola1 C T 3: 96,197,110 G56D probably benign Het
Brsk1 A G 7: 4,704,219 D257G probably damaging Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Cbs G T 17: 31,620,949 A337E probably benign Het
Ccdc129 T C 6: 55,968,541 F749S probably benign Het
Ccdc186 A C 19: 56,809,220 H306Q probably benign Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Chrnb1 C A 11: 69,785,762 D388Y probably damaging Het
Clcn1 T A 6: 42,299,514 F360Y possibly damaging Het
Clgn A G 8: 83,423,030 S387G probably damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Coil G A 11: 88,973,976 V10I probably damaging Het
Col4a1 G A 8: 11,212,712 P1256S possibly damaging Het
Copa T A 1: 172,111,987 F597Y probably benign Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Crybg1 T A 10: 44,004,019 Q391L probably damaging Het
Cspg4 G T 9: 56,898,537 V2211L probably benign Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dhx30 T C 9: 110,098,751 H101R probably damaging Het
Dnah11 T A 12: 117,916,931 D3818V probably damaging Het
Dnah17 C T 11: 118,069,519 C2572Y possibly damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Ehf T G 2: 103,273,906 T186P possibly damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Fam187b C T 7: 30,989,020 Q268* probably null Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fat3 A C 9: 15,996,315 V2797G possibly damaging Het
Fcamr A G 1: 130,804,569 R98G probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Fut10 T A 8: 31,201,390 S88T probably benign Het
Gabarap C T 11: 69,991,689 probably benign Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Glrx2 C T 1: 143,739,740 A27V possibly damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm5346 T C 8: 43,625,583 N535D probably damaging Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Gse1 G A 8: 120,568,253 probably benign Het
Heatr4 T C 12: 83,967,572 I630M probably benign Het
Hectd4 A T 5: 121,301,839 Y1134F possibly damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ildr1 A T 16: 36,708,336 T48S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 CTC CTCTTC 1: 135,386,271 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnh5 T C 12: 75,137,691 D86G probably benign Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Kif1b T C 4: 149,187,722 T1541A probably damaging Het
Kif21b A G 1: 136,160,121 I983V possibly damaging Het
Kif26a T C 12: 112,176,785 S1158P possibly damaging Het
Kmt2d A G 15: 98,865,132 C279R probably damaging Het
Kpna3 T A 14: 61,367,701 E499V probably benign Het
Krt16 T C 11: 100,247,707 E205G probably damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Mb21d2 A G 16: 28,828,421 V267A probably benign Het
Mfrp A G 9: 44,104,587 T334A possibly damaging Het
Morc1 T A 16: 48,612,297 D709E probably benign Het
Mrgpra2b A G 7: 47,464,879 I35T probably benign Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Mycbp2 A T 14: 103,155,178 C3206S probably damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ndufaf7 A T 17: 78,937,629 K59M probably damaging Het
Necab3 T C 2: 154,546,875 S208G probably benign Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1026 T A 2: 85,924,122 L285I possibly damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr402 A G 11: 74,155,976 D274G probably damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr870 A T 9: 20,170,913 Y219* probably null Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Otoa T C 7: 121,125,439 V447A probably benign Het
Papss1 A G 3: 131,605,967 N319D probably benign Het
Pcdhb3 G A 18: 37,301,878 G299D probably damaging Het
Pcsk4 T C 10: 80,323,570 D432G probably damaging Het
Pde5a G T 3: 122,748,240 L126F probably damaging Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pinx1 A G 14: 63,878,110 probably null Het
Plec C A 15: 76,177,692 E2547* probably null Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Ppil2 C G 16: 17,089,419 probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Prrx1 T A 1: 163,261,967 N97I probably damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Rbsn A T 6: 92,190,019 L548Q possibly damaging Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A C 1: 133,356,457 K187Q probably benign Het
Ren1 C A 1: 133,358,982 probably null Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep G C 1: 135,283,977 A11G probably benign Het
Ryr2 C T 13: 11,587,422 V4525M possibly damaging Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Sis A T 3: 72,965,645 C53* probably null Het
Slc13a5 C T 11: 72,266,459 probably null Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc9a8 T C 2: 167,424,145 F14S probably benign Het
Spock3 T C 8: 63,348,977 L330P probably damaging Het
Stab2 T G 10: 86,938,039 R809S probably benign Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Tecta G A 9: 42,391,922 T138I probably benign Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Traf7 A G 17: 24,512,379 F228L probably damaging Het
Trhr A G 15: 44,197,153 E23G probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Tubgcp2 T C 7: 139,998,055 T779A probably benign Het
Tusc2 A T 9: 107,564,631 I68F probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Upf2 A T 2: 6,027,450 S191C probably damaging Het
Usp24 A G 4: 106,360,421 N447S possibly damaging Het
Usp42 T C 5: 143,714,626 D1214G probably damaging Het
Vcam1 T A 3: 116,114,515 I633L probably benign Het
Vmn2r73 T C 7: 85,857,878 Y742C probably damaging Het
Vmn2r81 C A 10: 79,270,655 T489K probably benign Het
Zan C A 5: 137,415,018 probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfp616 A C 11: 74,085,771 K955N probably damaging Het
Zfyve9 A C 4: 108,718,501 V461G possibly damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Patj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Patj APN 4 98465106 missense probably damaging 1.00
IGL00095:Patj APN 4 98535562 missense possibly damaging 0.78
IGL00517:Patj APN 4 98441071 missense possibly damaging 0.95
IGL00802:Patj APN 4 98424406 missense possibly damaging 0.93
IGL01064:Patj APN 4 98496973 missense possibly damaging 0.95
IGL01110:Patj APN 4 98413024 missense probably damaging 0.99
IGL01407:Patj APN 4 98413050 missense possibly damaging 0.49
IGL01821:Patj APN 4 98456211 missense probably damaging 1.00
IGL02399:Patj APN 4 98591936 missense probably damaging 1.00
IGL02494:Patj APN 4 98703987 splice site probably benign
IGL02803:Patj APN 4 98426064 missense probably damaging 0.99
IGL02931:Patj APN 4 98411173 splice site probably benign
IGL03017:Patj APN 4 98465027 splice site probably benign
IGL03115:Patj APN 4 98443803 missense probably damaging 1.00
IGL03209:Patj APN 4 98465140 missense probably null 1.00
IGL03377:Patj APN 4 98465104 missense probably damaging 1.00
D4186:Patj UTSW 4 98638762 missense probably benign 0.17
R0136:Patj UTSW 4 98667648 missense probably damaging 1.00
R0294:Patj UTSW 4 98497048 missense probably damaging 0.99
R0376:Patj UTSW 4 98568987 missense probably damaging 1.00
R0463:Patj UTSW 4 98674308 missense probably damaging 1.00
R0465:Patj UTSW 4 98535507 splice site probably null
R0466:Patj UTSW 4 98688156 missense probably damaging 1.00
R0544:Patj UTSW 4 98569110 missense probably damaging 1.00
R0624:Patj UTSW 4 98681235 splice site probably benign
R0657:Patj UTSW 4 98667648 missense probably damaging 1.00
R1281:Patj UTSW 4 98416695 missense probably damaging 1.00
R1393:Patj UTSW 4 98424411 missense probably benign 0.01
R1480:Patj UTSW 4 98469582 missense probably damaging 1.00
R1667:Patj UTSW 4 98413027 missense probably damaging 1.00
R1729:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1797:Patj UTSW 4 98687438 missense probably damaging 1.00
R1818:Patj UTSW 4 98623648 missense possibly damaging 0.85
R1835:Patj UTSW 4 98491590 missense probably benign 0.00
R1880:Patj UTSW 4 98497240 missense probably benign 0.00
R2009:Patj UTSW 4 98456169 missense probably damaging 1.00
R2090:Patj UTSW 4 98437323 unclassified probably benign
R2120:Patj UTSW 4 98456225 missense probably benign 0.01
R2180:Patj UTSW 4 98523502 critical splice donor site probably null
R2655:Patj UTSW 4 98437450 missense possibly damaging 0.64
R3156:Patj UTSW 4 98674228 missense probably damaging 1.00
R3749:Patj UTSW 4 98469600 missense probably damaging 1.00
R3767:Patj UTSW 4 98681219 nonsense probably null
R3913:Patj UTSW 4 98569101 missense probably damaging 0.99
R3917:Patj UTSW 4 98592008 nonsense probably null
R3918:Patj UTSW 4 98456218 missense probably damaging 1.00
R4299:Patj UTSW 4 98677321 missense possibly damaging 0.89
R4355:Patj UTSW 4 98650454 missense possibly damaging 0.87
R4471:Patj UTSW 4 98535579 missense probably damaging 1.00
R4762:Patj UTSW 4 98405570 nonsense probably null
R4877:Patj UTSW 4 98569058 missense possibly damaging 0.94
R4945:Patj UTSW 4 98495064 missense probably damaging 0.97
R5274:Patj UTSW 4 98518981 missense probably damaging 0.99
R5343:Patj UTSW 4 98676193 missense probably damaging 1.00
R5554:Patj UTSW 4 98454396 missense possibly damaging 0.79
R5688:Patj UTSW 4 98520810 nonsense probably null
R5880:Patj UTSW 4 98411145 missense probably damaging 0.96
R5972:Patj UTSW 4 98569053 missense probably damaging 0.98
R6149:Patj UTSW 4 98424325 missense possibly damaging 0.72
R6192:Patj UTSW 4 98456157 missense probably damaging 1.00
R6265:Patj UTSW 4 98469567 missense probably benign 0.08
R6350:Patj UTSW 4 98405618 missense probably benign 0.26
R6363:Patj UTSW 4 98431860 missense probably benign 0.25
R6434:Patj UTSW 4 98491629 missense probably damaging 1.00
R6496:Patj UTSW 4 98416752 missense probably damaging 1.00
R6896:Patj UTSW 4 98426050 missense possibly damaging 0.87
Predicted Primers
Posted On2014-05-23