Incidental Mutation 'R0085:Hsd17b14'
ID19855
Institutional Source Beutler Lab
Gene Symbol Hsd17b14
Ensembl Gene ENSMUSG00000030825
Gene Namehydroxysteroid (17-beta) dehydrogenase 14
Synonyms0610039E24Rik, Dhrs10, retSDR3
MMRRC Submission 038372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0085 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45554893-45567752 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 45556410 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051810] [ENSMUST00000107752] [ENSMUST00000209517] [ENSMUST00000210300] [ENSMUST00000211155] [ENSMUST00000211797]
Predicted Effect probably benign
Transcript: ENSMUST00000051810
SMART Domains Protein: ENSMUSP00000051468
Gene: ENSMUSG00000040428

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107752
SMART Domains Protein: ENSMUSP00000103381
Gene: ENSMUSG00000030825

DomainStartEndE-ValueType
Pfam:KR 10 187 4.3e-12 PFAM
Pfam:adh_short 10 200 2.9e-53 PFAM
Pfam:Epimerase 12 184 4.2e-7 PFAM
Pfam:adh_short_C2 16 250 8.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209517
Predicted Effect probably benign
Transcript: ENSMUST00000210300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210460
Predicted Effect probably benign
Transcript: ENSMUST00000210797
Predicted Effect probably benign
Transcript: ENSMUST00000210997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211106
Predicted Effect probably benign
Transcript: ENSMUST00000211155
Predicted Effect probably benign
Transcript: ENSMUST00000211348
Predicted Effect probably benign
Transcript: ENSMUST00000211797
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 17-beta-hydroxysteroid dehydrogenases, such as HSD17B14, are primarily involved in metabolism of steroids at the C17 position and also of other substrates, such as fatty acids, prostaglandins, and xenobiotics (Lukacik et al., 2007 [PubMed 17067289]).[supplied by OMIM, Jun 2009]
PHENOTYPE: In a high-throughput phenotyping screen, male null mice exhibit infertility, decreased sperm production, testicular degeneration and an increased anxiety-like response to stress-induced hyperthermia. Homozygous null mice also show an increase in serum IgG2a in response to antigen challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,711,739 S583R probably damaging Het
Acad12 A G 5: 121,604,294 I417T possibly damaging Het
Adcy9 T C 16: 4,288,224 T1009A probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baat T C 4: 49,490,425 probably benign Het
Bpi T A 2: 158,273,152 L311* probably null Het
Brd2 A C 17: 34,113,259 F294L probably damaging Het
Carmil1 T A 13: 24,025,867 E804D probably benign Het
Cd209g A T 8: 4,134,785 probably benign Het
Cfi A G 3: 129,874,986 I554V probably benign Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Dst T C 1: 34,229,187 S2897P probably damaging Het
Efcab7 T C 4: 99,904,680 probably benign Het
Fbxo2 T C 4: 148,164,910 probably null Het
Fgfr2 C A 7: 130,196,263 R400L probably damaging Het
Il23r T C 6: 67,486,222 N96D probably damaging Het
Ints13 T A 6: 146,574,787 probably benign Het
Lig1 A G 7: 13,307,570 I776V possibly damaging Het
Madd T C 2: 91,162,738 I997V probably benign Het
Mgat4b C T 11: 50,230,999 H116Y possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo5b A C 18: 74,701,680 D937A probably benign Het
Nox3 T C 17: 3,635,281 N584S probably benign Het
Ogfr A G 2: 180,591,037 probably null Het
Olfr1341 T C 4: 118,709,881 V158A probably benign Het
Olfr741 T A 14: 50,486,334 M292K probably benign Het
Olfr904 T C 9: 38,464,662 I207T probably benign Het
Osbpl6 G T 2: 76,593,414 V728F probably benign Het
Picalm T A 7: 90,182,317 S453T probably benign Het
Piezo1 A G 8: 122,501,615 L310P probably damaging Het
Pitrm1 C T 13: 6,549,568 probably benign Het
Pkd1 T C 17: 24,586,223 F3250L probably damaging Het
Plekha4 C T 7: 45,543,949 R376* probably null Het
Pnmal2 A T 7: 16,945,549 S153C unknown Het
Rp1l1 C T 14: 64,022,295 R129W probably damaging Het
Ryr3 A G 2: 112,859,763 V1147A probably damaging Het
Sema3d G A 5: 12,570,986 V520I probably benign Het
Sgsm1 A G 5: 113,279,270 probably benign Het
Slc13a2 A G 11: 78,406,868 V58A probably damaging Het
Slc1a4 A G 11: 20,304,510 probably benign Het
Slc4a10 G A 2: 62,244,346 probably benign Het
Tab1 G T 15: 80,155,893 A305S probably benign Het
Tmem30a T A 9: 79,771,294 T327S probably benign Het
Tpr A C 1: 150,417,413 E863A possibly damaging Het
Upk3bl A G 5: 136,060,115 N161D probably benign Het
Ush1c T A 7: 46,225,555 I131F probably damaging Het
Wdfy4 C A 14: 33,078,243 R1975S possibly damaging Het
Zbtb18 C T 1: 177,447,935 A287V probably benign Het
Zfp712 T C 13: 67,041,192 T424A probably benign Het
Zfp791 G T 8: 85,112,233 Y56* probably null Het
Other mutations in Hsd17b14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hsd17b14 APN 7 45566713 missense possibly damaging 0.72
IGL02504:Hsd17b14 APN 7 45556375 missense possibly damaging 0.84
IGL03126:Hsd17b14 APN 7 45556079 missense possibly damaging 0.83
IGL03279:Hsd17b14 APN 7 45566193 missense possibly damaging 0.72
IGL03493:Hsd17b14 APN 7 45556091 missense probably damaging 1.00
R4128:Hsd17b14 UTSW 7 45563008 missense probably damaging 1.00
R4513:Hsd17b14 UTSW 7 45562915 missense probably benign 0.24
R5903:Hsd17b14 UTSW 7 45565962 missense probably damaging 1.00
R6649:Hsd17b14 UTSW 7 45556076 missense probably damaging 1.00
R6899:Hsd17b14 UTSW 7 45562928 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGTGATTCAGTGTTCGATTCTCCCTTG -3'
(R):5'- GGGCTAAACCTGGAGGCACATAAC -3'

Sequencing Primer
(F):5'- AGGAATTCAAGTCCTGGCTTTC -3'
(R):5'- CACATAACAGATTCTGAGTGCAG -3'
Posted On2013-04-11