Incidental Mutation 'R1728:Zan'
Institutional Source Beutler Lab
Gene Symbol Zan
Ensembl Gene ENSMUSG00000079173
Gene Namezonadhesin
MMRRC Submission 039760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1728 (G1)
Quality Score225
Status Not validated
Chromosomal Location137378637-137477064 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 137415018 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000117564] [ENSMUST00000164178]
Predicted Effect unknown
Transcript: ENSMUST00000117564
AA Change: C3217F
SMART Domains Protein: ENSMUSP00000114068
Gene: ENSMUSG00000079173
AA Change: C3217F

signal peptide 1 17 N/A INTRINSIC
MAM 42 210 3.55e-20 SMART
MAM 214 374 3.97e-9 SMART
MAM 375 542 5.7e-42 SMART
low complexity region 549 563 N/A INTRINSIC
low complexity region 578 607 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
low complexity region 672 689 N/A INTRINSIC
low complexity region 702 779 N/A INTRINSIC
low complexity region 782 865 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 941 1038 N/A INTRINSIC
low complexity region 1043 1084 N/A INTRINSIC
low complexity region 1096 1131 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
EGF_like 1236 1259 7.09e1 SMART
VWC 1266 1356 5e-3 SMART
VWD 1316 1477 3.73e-36 SMART
C8 1521 1596 6.91e-23 SMART
EGF_like 1607 1647 6.41e1 SMART
VWC 1654 1745 1.08e-2 SMART
VWD 1703 1869 2.71e-47 SMART
C8 1908 1982 3.45e-32 SMART
Pfam:TIL 1985 2039 4.5e-13 PFAM
VWC 2041 2095 4.84e-1 SMART
FOLN 2074 2096 9.79e1 SMART
VWD 2088 2260 5.49e-25 SMART
C8 2307 2381 6.73e-3 SMART
Pfam:TIL 2384 2442 3e-12 PFAM
VWC 2444 2504 1.13e-1 SMART
FOLN 2475 2498 3.73e0 SMART
EGF_like 2512 2557 6.54e1 SMART
VWC 2564 2637 3.68e-2 SMART
FOLN 2595 2618 4.04e0 SMART
VWC 2684 2744 3.08e-1 SMART
FOLN 2715 2738 7.78e0 SMART
VWC 2804 2864 1.7e0 SMART
FOLN 2835 2858 2.58e1 SMART
VWC 2924 2984 4.74e-1 SMART
VWC 3044 3104 2.44e-1 SMART
VWC 3164 3237 7.57e-2 SMART
FOLN 3195 3218 2.25e1 SMART
VWC 3284 3344 4.22e-1 SMART
FOLN 3315 3338 2.1e0 SMART
VWC 3401 3461 7.67e-2 SMART
FOLN 3432 3455 4.39e0 SMART
VWC 3521 3581 8.45e-2 SMART
FOLN 3552 3575 1.27e1 SMART
VWC 3641 3714 3.51e-1 SMART
FOLN 3672 3695 2.16e0 SMART
VWC 3761 3821 9.7e-2 SMART
FOLN 3792 3815 1.27e1 SMART
VWC 3881 3954 1.83e-1 SMART
FOLN 3912 3933 1.17e1 SMART
VWC 3997 4050 3.61e-1 SMART
FOLN 4028 4051 1.84e0 SMART
EGF_like 4081 4126 5.79e1 SMART
VWC 4133 4210 4.03e-1 SMART
FOLN 4164 4187 7.99e0 SMART
VWC 4253 4308 3.21e-1 SMART
FOLN 4284 4302 8.54e1 SMART
VWC 4368 4428 2.74e-2 SMART
FOLN 4399 4422 7.46e1 SMART
VWC 4488 4548 6.37e-1 SMART
FOLN 4519 4542 1.04e0 SMART
VWC 4608 4681 4.47e-1 SMART
FOLN 4639 4662 2.22e0 SMART
VWC 4728 4781 1.12e0 SMART
FOLN 4759 4782 3.29e1 SMART
EGF 4800 4841 2.43e1 SMART
VWC 4848 4901 7.59e-1 SMART
FOLN 4879 4902 5.31e0 SMART
VWD 4899 5061 4.49e-30 SMART
low complexity region 5086 5102 N/A INTRINSIC
C8 5113 5191 8.25e-21 SMART
Pfam:TIL 5194 5247 1.9e-12 PFAM
VWC 5249 5307 1.22e0 SMART
EGF 5306 5339 3.15e-3 SMART
transmembrane domain 5356 5378 N/A INTRINSIC
low complexity region 5381 5399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150470
SMART Domains Protein: ENSMUSP00000114562
Gene: ENSMUSG00000079173

Pfam:TIL 1 54 1.9e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000164178
AA Change: C3217F
SMART Domains Protein: ENSMUSP00000132895
Gene: ENSMUSG00000079173
AA Change: C3217F

signal peptide 1 17 N/A INTRINSIC
MAM 42 210 3.55e-20 SMART
MAM 214 374 3.97e-9 SMART
MAM 375 542 5.7e-42 SMART
low complexity region 549 563 N/A INTRINSIC
low complexity region 578 607 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
low complexity region 672 689 N/A INTRINSIC
low complexity region 702 779 N/A INTRINSIC
low complexity region 782 865 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 941 1038 N/A INTRINSIC
low complexity region 1043 1084 N/A INTRINSIC
low complexity region 1096 1131 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
EGF_like 1236 1259 7.09e1 SMART
VWC 1266 1356 5e-3 SMART
VWD 1316 1477 3.73e-36 SMART
C8 1521 1596 6.91e-23 SMART
EGF_like 1607 1647 6.41e1 SMART
VWC 1654 1745 1.08e-2 SMART
VWD 1703 1869 2.71e-47 SMART
C8 1908 1982 3.45e-32 SMART
Pfam:TIL 1985 2039 2.3e-13 PFAM
VWC 2041 2095 4.84e-1 SMART
FOLN 2074 2096 9.79e1 SMART
VWD 2088 2260 5.49e-25 SMART
C8 2307 2381 6.73e-3 SMART
Pfam:TIL 2384 2442 6e-12 PFAM
VWC 2444 2504 1.13e-1 SMART
FOLN 2475 2498 3.73e0 SMART
EGF_like 2512 2557 6.54e1 SMART
VWC 2564 2637 3.68e-2 SMART
FOLN 2595 2618 4.04e0 SMART
VWC 2684 2744 3.08e-1 SMART
FOLN 2715 2738 7.78e0 SMART
VWC 2804 2864 1.7e0 SMART
FOLN 2835 2858 2.58e1 SMART
VWC 2924 2984 4.74e-1 SMART
VWC 3044 3104 2.44e-1 SMART
VWC 3164 3237 7.57e-2 SMART
FOLN 3195 3218 2.25e1 SMART
VWC 3284 3344 4.22e-1 SMART
FOLN 3315 3338 2.1e0 SMART
VWC 3401 3461 7.67e-2 SMART
FOLN 3432 3455 4.39e0 SMART
VWC 3521 3581 8.45e-2 SMART
FOLN 3552 3575 1.27e1 SMART
VWC 3641 3714 3.51e-1 SMART
FOLN 3672 3695 2.16e0 SMART
VWC 3761 3821 9.7e-2 SMART
FOLN 3792 3815 1.27e1 SMART
VWC 3881 3954 1.83e-1 SMART
FOLN 3912 3933 1.17e1 SMART
VWC 3997 4050 3.61e-1 SMART
FOLN 4028 4051 1.84e0 SMART
EGF_like 4081 4126 5.79e1 SMART
VWC 4133 4210 4.03e-1 SMART
FOLN 4164 4187 7.99e0 SMART
VWC 4253 4308 3.21e-1 SMART
FOLN 4284 4302 8.54e1 SMART
VWC 4368 4428 2.74e-2 SMART
FOLN 4399 4422 7.46e1 SMART
VWC 4488 4548 6.37e-1 SMART
FOLN 4519 4542 1.04e0 SMART
VWC 4608 4681 4.47e-1 SMART
FOLN 4639 4662 2.22e0 SMART
VWC 4728 4781 1.12e0 SMART
FOLN 4759 4782 3.29e1 SMART
EGF 4800 4841 2.43e1 SMART
VWC 4848 4901 7.59e-1 SMART
FOLN 4879 4902 5.31e0 SMART
VWD 4899 5061 4.49e-30 SMART
low complexity region 5086 5102 N/A INTRINSIC
C8 5113 5191 8.25e-21 SMART
Pfam:TIL 5194 5247 7.2e-13 PFAM
VWC 5249 5307 1.22e0 SMART
EGF 5306 5339 3.15e-3 SMART
transmembrane domain 5356 5378 N/A INTRINSIC
low complexity region 5381 5399 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the species specificity of sperm adhesion to the egg zona pellucida. The encoded protein is located in the acrosome and may be involved in signaling or gamete recognition. An allelic polymorphism in this gene results in both functional and frameshifted alleles; the reference genome represents the functional allele. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Sperm from mice homozygous for a knock-out allele exhibit decreased species-specific zona pellucida adhesion without alteration in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 223 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,439,600 probably benign Het
Aadat A G 8: 60,526,712 T203A probably damaging Het
Abca13 T A 11: 9,249,680 F104L probably benign Het
Acox1 T A 11: 116,198,283 probably null Het
Adamts17 C T 7: 67,149,956 R1060* probably null Het
Adgrg6 T C 10: 14,439,782 T593A probably damaging Het
Ankrd12 G T 17: 65,984,076 P1454Q probably benign Het
Ap2m1 T A 16: 20,539,338 N35K probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Atr G A 9: 95,897,581 V1331I probably benign Het
Bola1 C T 3: 96,197,110 G56D probably benign Het
Brsk1 A G 7: 4,704,219 D257G probably damaging Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Cbs G T 17: 31,620,949 A337E probably benign Het
Ccdc129 T C 6: 55,968,541 F749S probably benign Het
Ccdc186 A C 19: 56,809,220 H306Q probably benign Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Chrnb1 C A 11: 69,785,762 D388Y probably damaging Het
Clcn1 T A 6: 42,299,514 F360Y possibly damaging Het
Clgn A G 8: 83,423,030 S387G probably damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Coil G A 11: 88,973,976 V10I probably damaging Het
Col4a1 G A 8: 11,212,712 P1256S possibly damaging Het
Copa T A 1: 172,111,987 F597Y probably benign Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Crybg1 T A 10: 44,004,019 Q391L probably damaging Het
Cspg4 G T 9: 56,898,537 V2211L probably benign Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dhx30 T C 9: 110,098,751 H101R probably damaging Het
Dnah11 T A 12: 117,916,931 D3818V probably damaging Het
Dnah17 C T 11: 118,069,519 C2572Y possibly damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Ehf T G 2: 103,273,906 T186P possibly damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Fam187b C T 7: 30,989,020 Q268* probably null Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fat3 A C 9: 15,996,315 V2797G possibly damaging Het
Fcamr A G 1: 130,804,569 R98G probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Fut10 T A 8: 31,201,390 S88T probably benign Het
Gabarap C T 11: 69,991,689 probably benign Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Glrx2 C T 1: 143,739,740 A27V possibly damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm5346 T C 8: 43,625,583 N535D probably damaging Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Gse1 G A 8: 120,568,253 probably benign Het
Heatr4 T C 12: 83,967,572 I630M probably benign Het
Hectd4 A T 5: 121,301,839 Y1134F possibly damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ildr1 A T 16: 36,708,336 T48S possibly damaging Het
Ipo9 CTC CTCTTC 1: 135,386,271 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnh5 T C 12: 75,137,691 D86G probably benign Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Kif1b T C 4: 149,187,722 T1541A probably damaging Het
Kif21b A G 1: 136,160,121 I983V possibly damaging Het
Kif26a T C 12: 112,176,785 S1158P possibly damaging Het
Kmt2d A G 15: 98,865,132 C279R probably damaging Het
Kpna3 T A 14: 61,367,701 E499V probably benign Het
Krt16 T C 11: 100,247,707 E205G probably damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Mb21d2 A G 16: 28,828,421 V267A probably benign Het
Mfrp A G 9: 44,104,587 T334A possibly damaging Het
Morc1 T A 16: 48,612,297 D709E probably benign Het
Mrgpra2b A G 7: 47,464,879 I35T probably benign Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Mycbp2 A T 14: 103,155,178 C3206S probably damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ndufaf7 A T 17: 78,937,629 K59M probably damaging Het
Necab3 T C 2: 154,546,875 S208G probably benign Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1026 T A 2: 85,924,122 L285I possibly damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr402 A G 11: 74,155,976 D274G probably damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr870 A T 9: 20,170,913 Y219* probably null Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Otoa T C 7: 121,125,439 V447A probably benign Het
Papss1 A G 3: 131,605,967 N319D probably benign Het
Patj G A 4: 98,431,780 G428D possibly damaging Het
Pcdhb3 G A 18: 37,301,878 G299D probably damaging Het
Pcsk4 T C 10: 80,323,570 D432G probably damaging Het
Pde5a G T 3: 122,748,240 L126F probably damaging Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pinx1 A G 14: 63,878,110 probably null Het
Plec C A 15: 76,177,692 E2547* probably null Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Ppil2 C G 16: 17,089,419 probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Prrx1 T A 1: 163,261,967 N97I probably damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Rbsn A T 6: 92,190,019 L548Q possibly damaging Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A C 1: 133,356,457 K187Q probably benign Het
Ren1 C A 1: 133,358,982 probably null Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep G C 1: 135,283,977 A11G probably benign Het
Ryr2 C T 13: 11,587,422 V4525M possibly damaging Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Sis A T 3: 72,965,645 C53* probably null Het
Slc13a5 C T 11: 72,266,459 probably null Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc9a8 T C 2: 167,424,145 F14S probably benign Het
Spock3 T C 8: 63,348,977 L330P probably damaging Het
Stab2 T G 10: 86,938,039 R809S probably benign Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Tecta G A 9: 42,391,922 T138I probably benign Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Traf7 A G 17: 24,512,379 F228L probably damaging Het
Trhr A G 15: 44,197,153 E23G probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Tubgcp2 T C 7: 139,998,055 T779A probably benign Het
Tusc2 A T 9: 107,564,631 I68F probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Upf2 A T 2: 6,027,450 S191C probably damaging Het
Usp24 A G 4: 106,360,421 N447S possibly damaging Het
Usp42 T C 5: 143,714,626 D1214G probably damaging Het
Vcam1 T A 3: 116,114,515 I633L probably benign Het
Vmn2r73 T C 7: 85,857,878 Y742C probably damaging Het
Vmn2r81 C A 10: 79,270,655 T489K probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfp616 A C 11: 74,085,771 K955N probably damaging Het
Zfyve9 A C 4: 108,718,501 V461G possibly damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Zan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zan APN 5 137387820 critical splice donor site probably null
IGL00158:Zan APN 5 137454257 missense unknown
IGL00473:Zan APN 5 137464250 missense possibly damaging 0.68
IGL00536:Zan APN 5 137446682 missense unknown
IGL00567:Zan APN 5 137416277 unclassified probably benign
IGL00820:Zan APN 5 137386364 missense unknown
IGL00850:Zan APN 5 137464113 missense unknown
IGL00906:Zan APN 5 137389360 missense unknown
IGL00920:Zan APN 5 137464524 missense unknown
IGL00964:Zan APN 5 137405941 unclassified probably benign
IGL01356:Zan APN 5 137436432 missense unknown
IGL01361:Zan APN 5 137414342 unclassified probably benign
IGL01362:Zan APN 5 137452450 missense unknown
IGL01411:Zan APN 5 137388893 missense unknown
IGL01412:Zan APN 5 137393032 missense unknown
IGL01531:Zan APN 5 137424612 missense unknown
IGL01561:Zan APN 5 137463866 missense unknown
IGL01564:Zan APN 5 137446733 missense unknown
IGL01568:Zan APN 5 137464844 missense unknown
IGL01719:Zan APN 5 137395654 missense unknown
IGL01732:Zan APN 5 137393011 missense unknown
IGL01761:Zan APN 5 137425597 missense unknown
IGL01771:Zan APN 5 137393068 missense unknown
IGL01810:Zan APN 5 137463626 missense unknown
IGL01845:Zan APN 5 137380854 unclassified probably benign
IGL01885:Zan APN 5 137464124 missense unknown
IGL01992:Zan APN 5 137424106 missense unknown
IGL02026:Zan APN 5 137405464 unclassified probably benign
IGL02065:Zan APN 5 137386960 nonsense probably null
IGL02133:Zan APN 5 137411498 missense possibly damaging 0.84
IGL02274:Zan APN 5 137421167 missense unknown
IGL02449:Zan APN 5 137389327 missense unknown
IGL02456:Zan APN 5 137446844 missense unknown
IGL02493:Zan APN 5 137435706 missense unknown
IGL02496:Zan APN 5 137464794 nonsense probably null
IGL02528:Zan APN 5 137465141 missense possibly damaging 0.83
IGL02550:Zan APN 5 137387039 missense unknown
IGL02598:Zan APN 5 137446211 missense unknown
IGL02697:Zan APN 5 137400548 missense unknown
IGL02933:Zan APN 5 137428414 missense unknown
IGL02963:Zan APN 5 137456250 missense unknown
IGL02972:Zan APN 5 137463686 missense unknown
IGL03068:Zan APN 5 137476415 missense probably damaging 1.00
IGL03104:Zan APN 5 137463500 missense unknown
IGL03110:Zan APN 5 137420016 missense unknown
IGL03156:Zan APN 5 137463939 missense unknown
IGL03302:Zan APN 5 137468390 missense possibly damaging 0.93
IGL03307:Zan APN 5 137474025 missense probably damaging 0.99
IGL03340:Zan APN 5 137427874 missense unknown
IGL03379:Zan APN 5 137464215 missense unknown
IGL03405:Zan APN 5 137424597 missense unknown
R0027:Zan UTSW 5 137406519 unclassified probably benign
R0047:Zan UTSW 5 137403656 missense unknown
R0149:Zan UTSW 5 137396766 missense unknown
R0240:Zan UTSW 5 137398362 missense unknown
R0240:Zan UTSW 5 137398362 missense unknown
R0241:Zan UTSW 5 137421822 missense unknown
R0241:Zan UTSW 5 137421822 missense unknown
R0361:Zan UTSW 5 137396766 missense unknown
R0432:Zan UTSW 5 137382316 unclassified probably benign
R0436:Zan UTSW 5 137464902 missense unknown
R0446:Zan UTSW 5 137391658 missense unknown
R0457:Zan UTSW 5 137407706 unclassified probably benign
R0478:Zan UTSW 5 137400526 splice site probably benign
R0487:Zan UTSW 5 137413358 critical splice donor site probably null
R0497:Zan UTSW 5 137412676 unclassified probably benign
R0504:Zan UTSW 5 137470318 missense probably damaging 1.00
R0545:Zan UTSW 5 137396177 missense unknown
R0556:Zan UTSW 5 137454220 missense unknown
R0615:Zan UTSW 5 137468431 missense probably damaging 1.00
R0737:Zan UTSW 5 137389249 missense unknown
R0835:Zan UTSW 5 137408397 unclassified probably benign
R0863:Zan UTSW 5 137458639 missense unknown
R0971:Zan UTSW 5 137434063 missense unknown
R1327:Zan UTSW 5 137465911 splice site probably benign
R1338:Zan UTSW 5 137393651 nonsense probably null
R1413:Zan UTSW 5 137427939 missense unknown
R1446:Zan UTSW 5 137389360 missense unknown
R1464:Zan UTSW 5 137419929 missense unknown
R1464:Zan UTSW 5 137419929 missense unknown
R1561:Zan UTSW 5 137380838 nonsense probably null
R1569:Zan UTSW 5 137429130 missense unknown
R1575:Zan UTSW 5 137461952 missense unknown
R1618:Zan UTSW 5 137383830 missense unknown
R1634:Zan UTSW 5 137412790 unclassified probably benign
R1650:Zan UTSW 5 137394601 splice site probably benign
R1680:Zan UTSW 5 137403050 missense unknown
R1698:Zan UTSW 5 137409669 utr 3 prime probably benign
R1704:Zan UTSW 5 137434002 nonsense probably null
R1729:Zan UTSW 5 137415018 unclassified probably benign
R1769:Zan UTSW 5 137464518 missense unknown
R1774:Zan UTSW 5 137419989 missense unknown
R1800:Zan UTSW 5 137386451 missense unknown
R1858:Zan UTSW 5 137405877 unclassified probably benign
R1888:Zan UTSW 5 137389328 missense unknown
R1888:Zan UTSW 5 137389328 missense unknown
R1925:Zan UTSW 5 137425642 missense unknown
R1938:Zan UTSW 5 137388939 missense unknown
R1955:Zan UTSW 5 137389283 missense unknown
R1989:Zan UTSW 5 137420006 nonsense probably null
R1997:Zan UTSW 5 137403114 nonsense probably null
R2008:Zan UTSW 5 137452450 missense unknown
R2035:Zan UTSW 5 137443947 missense unknown
R2153:Zan UTSW 5 137436400 missense unknown
R2154:Zan UTSW 5 137414249 unclassified probably benign
R2176:Zan UTSW 5 137421848 missense unknown
R2217:Zan UTSW 5 137410306 utr 3 prime probably benign
R2218:Zan UTSW 5 137410306 utr 3 prime probably benign
R2237:Zan UTSW 5 137457837 nonsense probably null
R2239:Zan UTSW 5 137457837 nonsense probably null
R2346:Zan UTSW 5 137421867 missense unknown
R2360:Zan UTSW 5 137396126 missense unknown
R2389:Zan UTSW 5 137476380 critical splice donor site probably null
R2412:Zan UTSW 5 137414163 splice site probably null
R2426:Zan UTSW 5 137388992 missense unknown
R2435:Zan UTSW 5 137438574 missense unknown
R2509:Zan UTSW 5 137456586 missense unknown
R3416:Zan UTSW 5 137435720 missense unknown
R3691:Zan UTSW 5 137420019 missense unknown
R3853:Zan UTSW 5 137474064 missense probably damaging 1.00
R4006:Zan UTSW 5 137463939 missense unknown
R4007:Zan UTSW 5 137463939 missense unknown
R4033:Zan UTSW 5 137437860 nonsense probably null
R4059:Zan UTSW 5 137436820 missense unknown
R4109:Zan UTSW 5 137458619 missense unknown
R4194:Zan UTSW 5 137463555 missense unknown
R4226:Zan UTSW 5 137423978 missense unknown
R4457:Zan UTSW 5 137411516 missense unknown
R4544:Zan UTSW 5 137383834 missense unknown
R4546:Zan UTSW 5 137383834 missense unknown
R4642:Zan UTSW 5 137464188 missense unknown
R4708:Zan UTSW 5 137446712 missense unknown
R4773:Zan UTSW 5 137436313 splice site probably benign
R4774:Zan UTSW 5 137389019 missense unknown
R4788:Zan UTSW 5 137442113 missense unknown
R4795:Zan UTSW 5 137380850 nonsense probably null
R4796:Zan UTSW 5 137380850 nonsense probably null
R4812:Zan UTSW 5 137456285 missense unknown
R4832:Zan UTSW 5 137393161 missense unknown
R4882:Zan UTSW 5 137438448 missense unknown
R4896:Zan UTSW 5 137386456 missense unknown
R4921:Zan UTSW 5 137408370 unclassified probably benign
R4943:Zan UTSW 5 137457890 missense unknown
R4978:Zan UTSW 5 137406921 unclassified probably benign
R5013:Zan UTSW 5 137383837 missense unknown
R5024:Zan UTSW 5 137461893 nonsense probably null
R5230:Zan UTSW 5 137454078 missense unknown
R5354:Zan UTSW 5 137380788 unclassified probably benign
R5380:Zan UTSW 5 137457840 missense unknown
R5394:Zan UTSW 5 137435634 missense unknown
R5394:Zan UTSW 5 137464074 missense unknown
R5435:Zan UTSW 5 137403762 missense unknown
R5441:Zan UTSW 5 137436751 missense unknown
R5447:Zan UTSW 5 137472191 missense probably damaging 1.00
R5455:Zan UTSW 5 137454000 missense unknown
R5495:Zan UTSW 5 137470408 missense probably damaging 1.00
R5496:Zan UTSW 5 137436345 missense unknown
R5523:Zan UTSW 5 137421893 missense unknown
R5534:Zan UTSW 5 137438451 missense unknown
R5572:Zan UTSW 5 137394431 missense unknown
R5576:Zan UTSW 5 137428482 nonsense probably null
R5587:Zan UTSW 5 137391762 missense unknown
R5593:Zan UTSW 5 137468338 missense possibly damaging 0.72
R5600:Zan UTSW 5 137386971 missense unknown
R5682:Zan UTSW 5 137414259 nonsense probably null
R5712:Zan UTSW 5 137400098 missense unknown
R5751:Zan UTSW 5 137410161 intron probably null
R5782:Zan UTSW 5 137420007 missense unknown
R5835:Zan UTSW 5 137456655 missense unknown
R5846:Zan UTSW 5 137394376 splice site probably null
R5903:Zan UTSW 5 137442134 missense unknown
R5911:Zan UTSW 5 137457912 missense unknown
R5935:Zan UTSW 5 137443930 missense unknown
R5985:Zan UTSW 5 137446037 intron probably null
R5995:Zan UTSW 5 137378809 unclassified probably benign
R6012:Zan UTSW 5 137464529 missense unknown
R6077:Zan UTSW 5 137414297 unclassified probably benign
R6227:Zan UTSW 5 137468343 missense probably damaging 0.96
R6262:Zan UTSW 5 137429485 intron probably null
R6337:Zan UTSW 5 137452488 missense unknown
R6598:Zan UTSW 5 137406364 unclassified probably benign
R6725:Zan UTSW 5 137438520 missense unknown
R6765:Zan UTSW 5 137393147 missense unknown
R6820:Zan UTSW 5 137407844 unclassified probably benign
R6829:Zan UTSW 5 137416278 unclassified probably benign
R6851:Zan UTSW 5 137396191 missense unknown
R6903:Zan UTSW 5 137456304 missense unknown
R6910:Zan UTSW 5 137419080 missense unknown
R6968:Zan UTSW 5 137461813 missense unknown
X0062:Zan UTSW 5 137446238 missense unknown
X0066:Zan UTSW 5 137464430 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tctaacagcctcttttgaccc -3'
Posted On2014-05-23