Incidental Mutation 'R1728:Dnah11'
ID198604
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Namedynein, axonemal, heavy chain 11
Synonymsb2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo
MMRRC Submission 039760-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R1728 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location117877982-118199043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117916931 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 3818 (D3818V)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
Predicted Effect probably damaging
Transcript: ENSMUST00000084806
AA Change: D3818V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: D3818V

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176239
Predicted Effect probably benign
Transcript: ENSMUST00000176756
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 223 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,439,600 probably benign Het
Aadat A G 8: 60,526,712 T203A probably damaging Het
Abca13 T A 11: 9,249,680 F104L probably benign Het
Acox1 T A 11: 116,198,283 probably null Het
Adamts17 C T 7: 67,149,956 R1060* probably null Het
Adgrg6 T C 10: 14,439,782 T593A probably damaging Het
Ankrd12 G T 17: 65,984,076 P1454Q probably benign Het
Ap2m1 T A 16: 20,539,338 N35K probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Atr G A 9: 95,897,581 V1331I probably benign Het
Bola1 C T 3: 96,197,110 G56D probably benign Het
Brsk1 A G 7: 4,704,219 D257G probably damaging Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Cbs G T 17: 31,620,949 A337E probably benign Het
Ccdc129 T C 6: 55,968,541 F749S probably benign Het
Ccdc186 A C 19: 56,809,220 H306Q probably benign Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Chrnb1 C A 11: 69,785,762 D388Y probably damaging Het
Clcn1 T A 6: 42,299,514 F360Y possibly damaging Het
Clgn A G 8: 83,423,030 S387G probably damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Coil G A 11: 88,973,976 V10I probably damaging Het
Col4a1 G A 8: 11,212,712 P1256S possibly damaging Het
Copa T A 1: 172,111,987 F597Y probably benign Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Crybg1 T A 10: 44,004,019 Q391L probably damaging Het
Cspg4 G T 9: 56,898,537 V2211L probably benign Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dhx30 T C 9: 110,098,751 H101R probably damaging Het
Dnah17 C T 11: 118,069,519 C2572Y possibly damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Ehf T G 2: 103,273,906 T186P possibly damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Fam187b C T 7: 30,989,020 Q268* probably null Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fat3 A C 9: 15,996,315 V2797G possibly damaging Het
Fcamr A G 1: 130,804,569 R98G probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Fut10 T A 8: 31,201,390 S88T probably benign Het
Gabarap C T 11: 69,991,689 probably benign Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Glrx2 C T 1: 143,739,740 A27V possibly damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm5346 T C 8: 43,625,583 N535D probably damaging Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Gse1 G A 8: 120,568,253 probably benign Het
Heatr4 T C 12: 83,967,572 I630M probably benign Het
Hectd4 A T 5: 121,301,839 Y1134F possibly damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ildr1 A T 16: 36,708,336 T48S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 CTC CTCTTC 1: 135,386,271 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnh5 T C 12: 75,137,691 D86G probably benign Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Kif1b T C 4: 149,187,722 T1541A probably damaging Het
Kif21b A G 1: 136,160,121 I983V possibly damaging Het
Kif26a T C 12: 112,176,785 S1158P possibly damaging Het
Kmt2d A G 15: 98,865,132 C279R probably damaging Het
Kpna3 T A 14: 61,367,701 E499V probably benign Het
Krt16 T C 11: 100,247,707 E205G probably damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Mb21d2 A G 16: 28,828,421 V267A probably benign Het
Mfrp A G 9: 44,104,587 T334A possibly damaging Het
Morc1 T A 16: 48,612,297 D709E probably benign Het
Mrgpra2b A G 7: 47,464,879 I35T probably benign Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Mycbp2 A T 14: 103,155,178 C3206S probably damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ndufaf7 A T 17: 78,937,629 K59M probably damaging Het
Necab3 T C 2: 154,546,875 S208G probably benign Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1026 T A 2: 85,924,122 L285I possibly damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr402 A G 11: 74,155,976 D274G probably damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr870 A T 9: 20,170,913 Y219* probably null Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Otoa T C 7: 121,125,439 V447A probably benign Het
Papss1 A G 3: 131,605,967 N319D probably benign Het
Patj G A 4: 98,431,780 G428D possibly damaging Het
Pcdhb3 G A 18: 37,301,878 G299D probably damaging Het
Pcsk4 T C 10: 80,323,570 D432G probably damaging Het
Pde5a G T 3: 122,748,240 L126F probably damaging Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pinx1 A G 14: 63,878,110 probably null Het
Plec C A 15: 76,177,692 E2547* probably null Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Ppil2 C G 16: 17,089,419 probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Prrx1 T A 1: 163,261,967 N97I probably damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Rbsn A T 6: 92,190,019 L548Q possibly damaging Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A C 1: 133,356,457 K187Q probably benign Het
Ren1 C A 1: 133,358,982 probably null Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep G C 1: 135,283,977 A11G probably benign Het
Ryr2 C T 13: 11,587,422 V4525M possibly damaging Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Sis A T 3: 72,965,645 C53* probably null Het
Slc13a5 C T 11: 72,266,459 probably null Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc9a8 T C 2: 167,424,145 F14S probably benign Het
Spock3 T C 8: 63,348,977 L330P probably damaging Het
Stab2 T G 10: 86,938,039 R809S probably benign Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Tecta G A 9: 42,391,922 T138I probably benign Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Traf7 A G 17: 24,512,379 F228L probably damaging Het
Trhr A G 15: 44,197,153 E23G probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Tubgcp2 T C 7: 139,998,055 T779A probably benign Het
Tusc2 A T 9: 107,564,631 I68F probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Upf2 A T 2: 6,027,450 S191C probably damaging Het
Usp24 A G 4: 106,360,421 N447S possibly damaging Het
Usp42 T C 5: 143,714,626 D1214G probably damaging Het
Vcam1 T A 3: 116,114,515 I633L probably benign Het
Vmn2r73 T C 7: 85,857,878 Y742C probably damaging Het
Vmn2r81 C A 10: 79,270,655 T489K probably benign Het
Zan C A 5: 137,415,018 probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfp616 A C 11: 74,085,771 K955N probably damaging Het
Zfyve9 A C 4: 108,718,501 V461G possibly damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118198745 missense probably benign 0.28
IGL00422:Dnah11 APN 12 118068096 missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118036459 missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118186922 missense probably benign 0.01
IGL00687:Dnah11 APN 12 117922004 splice site probably benign
IGL00833:Dnah11 APN 12 118179580 missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117911202 missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118196651 missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118142934 splice site probably benign
IGL01121:Dnah11 APN 12 118050695 missense probably benign 0.02
IGL01143:Dnah11 APN 12 118012740 missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117982999 missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118192399 missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118047256 nonsense probably null
IGL01418:Dnah11 APN 12 117987482 nonsense probably null
IGL01444:Dnah11 APN 12 118020232 missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117983032 missense probably benign 0.15
IGL01645:Dnah11 APN 12 118186998 missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118192270 splice site probably benign
IGL02104:Dnah11 APN 12 118192390 missense probably benign
IGL02151:Dnah11 APN 12 118059888 splice site probably benign
IGL02189:Dnah11 APN 12 118082579 missense probably benign 0.00
IGL02417:Dnah11 APN 12 118057180 missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118186902 missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117975873 splice site probably benign
IGL02474:Dnah11 APN 12 118027445 splice site probably null
IGL02526:Dnah11 APN 12 118179618 missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117911040 missense probably damaging 1.00
IGL03011:Dnah11 APN 12 118012377 missense probably benign 0.08
IGL03061:Dnah11 APN 12 117903121 missense probably damaging 1.00
IGL03182:Dnah11 APN 12 118030291 missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118105985 missense probably benign
IGL03238:Dnah11 APN 12 118109898 missense probably damaging 1.00
IGL03493:Dnah11 APN 12 118012798 missense probably benign 0.00
P0045:Dnah11 UTSW 12 118030327 missense probably benign
R0009:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118126886 missense probably benign 0.05
R0172:Dnah11 UTSW 12 117987453 missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117983056 nonsense probably null
R0270:Dnah11 UTSW 12 118041013 missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118127133 missense probably benign 0.03
R0325:Dnah11 UTSW 12 118012339 missense probably benign
R0370:Dnah11 UTSW 12 117995227 missense probably benign
R0416:Dnah11 UTSW 12 117911058 missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118106510 missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117931178 missense probably benign 0.01
R0607:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117987469 missense probably damaging 1.00
R0635:Dnah11 UTSW 12 118007996 missense probably damaging 1.00
R0755:Dnah11 UTSW 12 117954829 missense possibly damaging 0.95
R0755:Dnah11 UTSW 12 118198625 missense probably benign 0.17
R0789:Dnah11 UTSW 12 117911232 missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0835:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0846:Dnah11 UTSW 12 117933850 missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118190844 nonsense probably null
R0928:Dnah11 UTSW 12 118045562 missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118060407 missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117933812 missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117972364 missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118057106 nonsense probably null
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1500:Dnah11 UTSW 12 118012829 synonymous probably null
R1535:Dnah11 UTSW 12 118018730 missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117931256 missense probably benign 0.01
R1554:Dnah11 UTSW 12 118082499 missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R1618:Dnah11 UTSW 12 118015465 missense probably damaging 0.98
R1638:Dnah11 UTSW 12 118015419 missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118120724 missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117933845 missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118190868 missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118196644 missense probably benign 0.32
R1729:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118190825 missense probably benign 0.31
R1780:Dnah11 UTSW 12 118027558 missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118038780 missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118063852 missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118127556 missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118082468 missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118113871 missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 118012716 missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 118020353 missense probably damaging 1.00
R2140:Dnah11 UTSW 12 118008810 missense probably benign 0.01
R2261:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2261:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2262:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2263:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2263:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117886686 missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117928330 missense probably damaging 1.00
R2410:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117987427 nonsense probably null
R3499:Dnah11 UTSW 12 117911023 missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3742:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3779:Dnah11 UTSW 12 118130713 splice site probably benign
R3785:Dnah11 UTSW 12 118017602 missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117978453 splice site probably benign
R4014:Dnah11 UTSW 12 117974914 missense probably benign 0.16
R4043:Dnah11 UTSW 12 117879943 missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118106492 missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4074:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4076:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4201:Dnah11 UTSW 12 117966659 missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118130892 missense probably benign 0.06
R4233:Dnah11 UTSW 12 117916791 missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118125843 nonsense probably null
R4430:Dnah11 UTSW 12 117983011 missense probably benign 0.26
R4465:Dnah11 UTSW 12 117987451 missense probably benign 0.09
R4489:Dnah11 UTSW 12 117916896 missense probably benign 0.31
R4572:Dnah11 UTSW 12 118010125 missense probably benign 0.00
R4574:Dnah11 UTSW 12 118012255 critical splice donor site probably null
R4657:Dnah11 UTSW 12 118192427 missense probably benign 0.02
R4709:Dnah11 UTSW 12 118018760 missense probably benign 0.26
R4740:Dnah11 UTSW 12 118120544 missense probably benign 0.28
R4803:Dnah11 UTSW 12 118127608 missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117995200 missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118126883 missense probably benign 0.37
R5018:Dnah11 UTSW 12 118130728 missense probably benign 0.00
R5071:Dnah11 UTSW 12 118082453 nonsense probably null
R5074:Dnah11 UTSW 12 118082453 nonsense probably null
R5080:Dnah11 UTSW 12 118198830 start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 118017700 missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117954751 missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118157361 missense probably benign 0.09
R5252:Dnah11 UTSW 12 118125941 missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117883416 missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118085680 missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117954893 missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118085697 missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117880451 critical splice donor site probably null
R5546:Dnah11 UTSW 12 117975848 missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 118018802 missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117883617 missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118113907 missense probably benign 0.04
R5706:Dnah11 UTSW 12 118023935 missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118127106 missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118192390 missense probably benign
R5884:Dnah11 UTSW 12 118177534 missense probably benign 0.00
R5900:Dnah11 UTSW 12 118082431 splice site probably null
R5905:Dnah11 UTSW 12 117954924 missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117914636 splice site probably null
R5973:Dnah11 UTSW 12 118110952 missense probably benign 0.02
R6024:Dnah11 UTSW 12 118030272 missense probably benign 0.34
R6056:Dnah11 UTSW 12 117928456 missense probably benign 0.03
R6075:Dnah11 UTSW 12 118104851 missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117928456 missense probably benign
R6191:Dnah11 UTSW 12 118190897 missense probably benign
R6197:Dnah11 UTSW 12 118179747 missense probably benign 0.03
R6262:Dnah11 UTSW 12 117931178 missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117916855 missense probably benign 0.01
R6614:Dnah11 UTSW 12 117886676 missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118186882 splice site probably null
R6712:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118045646 missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118113894 missense possibly damaging 0.82
R6895:Dnah11 UTSW 12 117995191 missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118106562 missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118198768 missense probably benign
R6945:Dnah11 UTSW 12 118060310 missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117933809 missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118108944 missense probably benign 0.00
R6976:Dnah11 UTSW 12 118198643 missense probably benign 0.16
Z1088:Dnah11 UTSW 12 117895012 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117982969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATTGCTCACCTCAGGGCATAC -3'
(R):5'- CCATCCACCAAGGCTTCTCATTGAC -3'

Sequencing Primer
(F):5'- GGCATACGTCATCCTGTCAG -3'
(R):5'- CTGACCCTTAGTCTAAGCAGG -3'
Posted On2014-05-23