Incidental Mutation 'R1728:Ryr2'
ID198605
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Nameryanodine receptor 2, cardiac
Synonyms9330127I20Rik
MMRRC Submission 039760-MU
Accession Numbers

Ncbi RefSeq: NM_023868.2; MGI: 99685

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1728 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location11553102-12106945 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11587422 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 4525 (V4525M)
Ref Sequence ENSEMBL: ENSMUSP00000127991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156] [ENSMUST00000221527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021750
AA Change: V4525M

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: V4525M

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170156
AA Change: V4525M

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: V4525M

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221527
AA Change: V960M

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222788
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 223 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,439,600 probably benign Het
Aadat A G 8: 60,526,712 T203A probably damaging Het
Abca13 T A 11: 9,249,680 F104L probably benign Het
Acox1 T A 11: 116,198,283 probably null Het
Adamts17 C T 7: 67,149,956 R1060* probably null Het
Adgrg6 T C 10: 14,439,782 T593A probably damaging Het
Ankrd12 G T 17: 65,984,076 P1454Q probably benign Het
Ap2m1 T A 16: 20,539,338 N35K probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Atr G A 9: 95,897,581 V1331I probably benign Het
Bola1 C T 3: 96,197,110 G56D probably benign Het
Brsk1 A G 7: 4,704,219 D257G probably damaging Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Cbs G T 17: 31,620,949 A337E probably benign Het
Ccdc129 T C 6: 55,968,541 F749S probably benign Het
Ccdc186 A C 19: 56,809,220 H306Q probably benign Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Chrnb1 C A 11: 69,785,762 D388Y probably damaging Het
Clcn1 T A 6: 42,299,514 F360Y possibly damaging Het
Clgn A G 8: 83,423,030 S387G probably damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Coil G A 11: 88,973,976 V10I probably damaging Het
Col4a1 G A 8: 11,212,712 P1256S possibly damaging Het
Copa T A 1: 172,111,987 F597Y probably benign Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Crybg1 T A 10: 44,004,019 Q391L probably damaging Het
Cspg4 G T 9: 56,898,537 V2211L probably benign Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dhx30 T C 9: 110,098,751 H101R probably damaging Het
Dnah11 T A 12: 117,916,931 D3818V probably damaging Het
Dnah17 C T 11: 118,069,519 C2572Y possibly damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Ehf T G 2: 103,273,906 T186P possibly damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Fam187b C T 7: 30,989,020 Q268* probably null Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fat3 A C 9: 15,996,315 V2797G possibly damaging Het
Fcamr A G 1: 130,804,569 R98G probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Fut10 T A 8: 31,201,390 S88T probably benign Het
Gabarap C T 11: 69,991,689 probably benign Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Glrx2 C T 1: 143,739,740 A27V possibly damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm5346 T C 8: 43,625,583 N535D probably damaging Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Gse1 G A 8: 120,568,253 probably benign Het
Heatr4 T C 12: 83,967,572 I630M probably benign Het
Hectd4 A T 5: 121,301,839 Y1134F possibly damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ildr1 A T 16: 36,708,336 T48S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 CTC CTCTTC 1: 135,386,271 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnh5 T C 12: 75,137,691 D86G probably benign Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Kif1b T C 4: 149,187,722 T1541A probably damaging Het
Kif21b A G 1: 136,160,121 I983V possibly damaging Het
Kif26a T C 12: 112,176,785 S1158P possibly damaging Het
Kmt2d A G 15: 98,865,132 C279R probably damaging Het
Kpna3 T A 14: 61,367,701 E499V probably benign Het
Krt16 T C 11: 100,247,707 E205G probably damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Mb21d2 A G 16: 28,828,421 V267A probably benign Het
Mfrp A G 9: 44,104,587 T334A possibly damaging Het
Morc1 T A 16: 48,612,297 D709E probably benign Het
Mrgpra2b A G 7: 47,464,879 I35T probably benign Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Mycbp2 A T 14: 103,155,178 C3206S probably damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ndufaf7 A T 17: 78,937,629 K59M probably damaging Het
Necab3 T C 2: 154,546,875 S208G probably benign Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1026 T A 2: 85,924,122 L285I possibly damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr402 A G 11: 74,155,976 D274G probably damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr870 A T 9: 20,170,913 Y219* probably null Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Otoa T C 7: 121,125,439 V447A probably benign Het
Papss1 A G 3: 131,605,967 N319D probably benign Het
Patj G A 4: 98,431,780 G428D possibly damaging Het
Pcdhb3 G A 18: 37,301,878 G299D probably damaging Het
Pcsk4 T C 10: 80,323,570 D432G probably damaging Het
Pde5a G T 3: 122,748,240 L126F probably damaging Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pinx1 A G 14: 63,878,110 probably null Het
Plec C A 15: 76,177,692 E2547* probably null Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Ppil2 C G 16: 17,089,419 probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Prrx1 T A 1: 163,261,967 N97I probably damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Rbsn A T 6: 92,190,019 L548Q possibly damaging Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A C 1: 133,356,457 K187Q probably benign Het
Ren1 C A 1: 133,358,982 probably null Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep G C 1: 135,283,977 A11G probably benign Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Sis A T 3: 72,965,645 C53* probably null Het
Slc13a5 C T 11: 72,266,459 probably null Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc9a8 T C 2: 167,424,145 F14S probably benign Het
Spock3 T C 8: 63,348,977 L330P probably damaging Het
Stab2 T G 10: 86,938,039 R809S probably benign Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Tecta G A 9: 42,391,922 T138I probably benign Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Traf7 A G 17: 24,512,379 F228L probably damaging Het
Trhr A G 15: 44,197,153 E23G probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Tubgcp2 T C 7: 139,998,055 T779A probably benign Het
Tusc2 A T 9: 107,564,631 I68F probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Upf2 A T 2: 6,027,450 S191C probably damaging Het
Usp24 A G 4: 106,360,421 N447S possibly damaging Het
Usp42 T C 5: 143,714,626 D1214G probably damaging Het
Vcam1 T A 3: 116,114,515 I633L probably benign Het
Vmn2r73 T C 7: 85,857,878 Y742C probably damaging Het
Vmn2r81 C A 10: 79,270,655 T489K probably benign Het
Zan C A 5: 137,415,018 probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfp616 A C 11: 74,085,771 K955N probably damaging Het
Zfyve9 A C 4: 108,718,501 V461G possibly damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11834092 splice site probably benign
IGL00757:Ryr2 APN 13 11618604 splice site probably null
IGL00838:Ryr2 APN 13 11568503 missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11585478 missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11735502 missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11703544 missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11638485 critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11587239 missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11556685 missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11591352 missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11742036 missense probably benign 0.10
IGL01419:Ryr2 APN 13 11799837 missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11851204 missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11721790 missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11721761 missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11601758 critical splice donor site probably null
IGL01611:Ryr2 APN 13 11591316 missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11594968 missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11692677 missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11585480 missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11601842 missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11595425 missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11554550 missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11597112 missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11747564 missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11572257 missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11792762 nonsense probably null
IGL02086:Ryr2 APN 13 11735556 missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11759759 missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11737873 missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11741869 missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11730388 missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11747658 splice site probably benign
IGL02369:Ryr2 APN 13 11619496 missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11722721 splice site probably benign
IGL02400:Ryr2 APN 13 11605244 splice site probably benign
IGL02423:Ryr2 APN 13 11745198 missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11745674 missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11705699 missense probably benign 0.15
IGL02602:Ryr2 APN 13 11554511 utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11605189 missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11738320 missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11655677 missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11595190 missense probably benign 0.21
IGL02876:Ryr2 APN 13 11707793 missense probably benign 0.39
IGL02878:Ryr2 APN 13 11918319 missense probably benign 0.10
IGL02887:Ryr2 APN 13 11591269 missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11759835 missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11684479 missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11643902 critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11635582 splice site probably benign
IGL03152:Ryr2 APN 13 11853150 missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11742023 nonsense probably null
IGL03180:Ryr2 APN 13 11568563 missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11724387 splice site probably benign
IGL03390:Ryr2 APN 13 11772416 missense probably benign
IGL03410:Ryr2 APN 13 11588147 missense probably damaging 0.99
Arruda UTSW 13 11643895 missense probably damaging 1.00
arruda2 UTSW 13 11879496 missense probably damaging 1.00
arruda3 UTSW 13 11555448 missense possibly damaging 0.91
H8562:Ryr2 UTSW 13 11717141 splice site probably benign
IGL02799:Ryr2 UTSW 13 11665962 missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11761306 missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11707796 missense probably damaging 0.97
R0003:Ryr2 UTSW 13 11824379 missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11665919 missense probably benign
R0018:Ryr2 UTSW 13 11595223 missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11669038 missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0080:Ryr2 UTSW 13 11568475 missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11709921 missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11714548 missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11676251 splice site probably benign
R0226:Ryr2 UTSW 13 11772556 missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11716977 missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11668839 missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11705684 missense probably benign 0.45
R0415:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11834095 splice site probably benign
R0558:Ryr2 UTSW 13 11638443 missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11799861 missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11731669 missense probably benign 0.02
R0586:Ryr2 UTSW 13 11635559 missense probably null
R0601:Ryr2 UTSW 13 11705633 critical splice donor site probably null
R0610:Ryr2 UTSW 13 11622952 missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11724333 missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11566885 missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11738126 missense probably benign 0.35
R0884:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11669969 missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11945981 missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11660113 missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11883043 critical splice donor site probably null
R1296:Ryr2 UTSW 13 11687879 splice site probably benign
R1400:Ryr2 UTSW 13 11595076 missense probably benign 0.08
R1439:Ryr2 UTSW 13 11714503 splice site probably benign
R1443:Ryr2 UTSW 13 11779266 missense probably benign 0.19
R1446:Ryr2 UTSW 13 11738149 missense probably benign 0.09
R1458:Ryr2 UTSW 13 11727022 missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11601841 missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11554592 missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11554549 nonsense probably null
R1551:Ryr2 UTSW 13 11785143 critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11759677 missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11794563 missense probably benign 0.01
R1645:Ryr2 UTSW 13 11718482 nonsense probably null
R1686:Ryr2 UTSW 13 11603779 splice site probably benign
R1696:Ryr2 UTSW 13 11731657 missense probably benign 0.02
R1708:Ryr2 UTSW 13 11587442 splice site probably null
R1745:Ryr2 UTSW 13 11790267 missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1776:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1783:Ryr2 UTSW 13 11700371 nonsense probably null
R1801:Ryr2 UTSW 13 11595281 missense probably benign 0.01
R1812:Ryr2 UTSW 13 11560586 missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11587316 missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11769878 missense probably benign 0.06
R1868:Ryr2 UTSW 13 11731700 missense probably benign 0.02
R1869:Ryr2 UTSW 13 11662075 missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11738356 missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11658958 nonsense probably null
R1897:Ryr2 UTSW 13 11750932 missense probably benign 0.09
R1899:Ryr2 UTSW 13 11591336 missense probably benign
R1909:Ryr2 UTSW 13 11700349 missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11556698 missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11668962 missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11731723 missense probably benign 0.10
R1956:Ryr2 UTSW 13 11681080 missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11585402 splice site probably null
R2018:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11595736 missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11665878 splice site probably null
R2088:Ryr2 UTSW 13 11662229 missense probably benign 0.04
R2089:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2127:Ryr2 UTSW 13 11712195 missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11560607 missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11577873 missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11705793 nonsense probably null
R2207:Ryr2 UTSW 13 11810937 missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11662260 missense probably benign 0.18
R2258:Ryr2 UTSW 13 11738216 missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11738242 missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11591237 missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11801848 missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11772580 critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11588159 missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11738209 missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11772427 missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11918414 missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11692682 missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11779267 missense probably benign 0.22
R4127:Ryr2 UTSW 13 11587437 missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11737873 missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11750725 missense probably benign 0.20
R4355:Ryr2 UTSW 13 11649812 missense probably benign 0.05
R4384:Ryr2 UTSW 13 11605233 missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11717066 nonsense probably null
R4430:Ryr2 UTSW 13 11735527 missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12106415 missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11749509 missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11750685 splice site probably null
R4668:Ryr2 UTSW 13 11593117 missense probably benign
R4677:Ryr2 UTSW 13 11706667 missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11824369 missense probably benign 0.34
R4680:Ryr2 UTSW 13 11595233 missense probably benign 0.04
R4685:Ryr2 UTSW 13 11692646 missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11716998 missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11737753 missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11657047 missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11717097 missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11655698 missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11668820 missense probably damaging 0.99
R4850:Ryr2 UTSW 13 11745752 missense probably damaging 1.00
R4880:Ryr2 UTSW 13 11752218 missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11709963 missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11945945 missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11742011 missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11785080 missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4964:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4966:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4997:Ryr2 UTSW 13 11595306 missense probably benign 0.09
R4998:Ryr2 UTSW 13 11643895 missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11587254 missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11635536 missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11700354 missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11712243 nonsense probably null
R5135:Ryr2 UTSW 13 11662130 missense probably benign 0.05
R5138:Ryr2 UTSW 13 11660289 missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11752321 missense probably benign
R5187:Ryr2 UTSW 13 11772452 missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11638430 critical splice donor site probably null
R5262:Ryr2 UTSW 13 11772437 missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11690363 missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11556658 missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11655713 missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11705656 missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11705701 missense probably null 0.15
R5509:Ryr2 UTSW 13 11745601 missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11687909 missense probably benign 0.01
R5571:Ryr2 UTSW 13 11555448 missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11595014 missense probably benign 0.06
R5619:Ryr2 UTSW 13 11708202 missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11601805 missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11595582 missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11759836 missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11769962 missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11603732 missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11560574 missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11584154 missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11790332 missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11687902 missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11660122 missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11726953 missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11662238 nonsense probably null
R5974:Ryr2 UTSW 13 11714511 splice site probably null
R6104:Ryr2 UTSW 13 11799825 missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11792689 missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11669017 missense probably benign
R6208:Ryr2 UTSW 13 11895220 missense probably benign 0.04
R6217:Ryr2 UTSW 13 11834078 missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11660107 missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11879496 missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11761396 missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11662383 missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11834007 missense probably benign 0.29
R6548:Ryr2 UTSW 13 11668821 missense probably damaging 1.00
R6590:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6623:Ryr2 UTSW 13 11710065 missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11595643 missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6770:Ryr2 UTSW 13 11738462 missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11686966 missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11726930 missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11829654 missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11827559 missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11745601 missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11566948 missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11801243 missense probably benign 0.28
S24628:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11703501 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GATACCTGGGGACTTACTTTCAAGCAG -3'
(R):5'- GATGAGACAGACCCTTTCTCACATGAC -3'

Sequencing Primer
(F):5'- CTTTCAAGCAGTAGTATCCGATG -3'
(R):5'- TCTGTTGGAAAAGCTGTCTCTTTAC -3'
Posted On2014-05-23