Incidental Mutation 'R1729:Fastkd2'
ID198627
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene NameFAST kinase domains 2
Synonyms2810421I24Rik
MMRRC Submission 039761-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R1729 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location63730614-63754655 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 63751300 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 628 (C628*)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027102] [ENSMUST00000027103]
Predicted Effect probably benign
Transcript: ENSMUST00000027102
Predicted Effect probably null
Transcript: ENSMUST00000027103
AA Change: C628*
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: C628*

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134454
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 225 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,439,600 probably benign Het
4930453N24Rik T C 16: 64,769,022 I90V probably damaging Het
Aadat A G 8: 60,526,712 T203A probably damaging Het
Adamts17 C T 7: 67,149,956 R1060* probably null Het
Adamts5 T A 16: 85,877,915 K454* probably null Het
Adgrg6 T C 10: 14,439,782 T593A probably damaging Het
Aldh1l2 T A 10: 83,508,082 K377* probably null Het
Aldh4a1 A G 4: 139,644,161 Y462C probably damaging Het
Ankrd12 G T 17: 65,984,076 P1454Q probably benign Het
Ap2m1 T A 16: 20,539,338 N35K probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Atr G A 9: 95,897,581 V1331I probably benign Het
Boc T C 16: 44,496,419 T454A probably benign Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Car14 G A 3: 95,901,248 P18L possibly damaging Het
Cbs G T 17: 31,620,949 A337E probably benign Het
Ccdc129 T C 6: 55,968,541 F749S probably benign Het
Ccdc186 A C 19: 56,809,220 H306Q probably benign Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cdk12 T C 11: 98,249,970 probably benign Het
Cep350 A T 1: 155,911,981 H1370Q probably benign Het
Cfh T C 1: 140,136,788 K374R probably benign Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chat A T 14: 32,446,795 L261H probably damaging Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Clcn1 T A 6: 42,299,514 F360Y possibly damaging Het
Clgn A G 8: 83,423,030 S387G probably damaging Het
Clk1 C T 1: 58,421,261 R70Q probably damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Cspg4 G T 9: 56,898,537 V2211L probably benign Het
Cwh43 T C 5: 73,408,218 L42P probably damaging Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
D830039M14Rik C T 10: 61,475,727 probably benign Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dhx30 T C 9: 110,098,751 H101R probably damaging Het
Dnah11 T A 12: 117,916,931 D3818V probably damaging Het
Dnah9 G A 11: 66,085,020 T1401I possibly damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Ehf T G 2: 103,273,906 T186P possibly damaging Het
Elf2 A T 3: 51,257,572 V277D probably damaging Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Eya2 G T 2: 165,687,663 G109W probably damaging Het
Fam208a A T 14: 27,479,633 N1367Y probably damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fam78b A G 1: 167,001,630 D22G possibly damaging Het
Fat3 A C 9: 15,996,315 V2797G possibly damaging Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Fut10 T A 8: 31,201,390 S88T probably benign Het
Gabarap C T 11: 69,991,689 probably benign Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Gm5346 T C 8: 43,625,583 N535D probably damaging Het
Gon4l T A 3: 88,903,098 D1844E probably damaging Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Guk1 A T 11: 59,185,312 V100E probably damaging Het
Ifi44l T C 3: 151,762,819 I25V unknown Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Kif18b A G 11: 102,915,541 probably null Het
Kif26a T C 12: 112,176,785 S1158P possibly damaging Het
Kmt2d A G 15: 98,865,132 C279R probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Krt23 A T 11: 99,492,964 V34D probably damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Mb21d2 A G 16: 28,828,421 V267A probably benign Het
Megf10 T C 18: 57,240,792 probably null Het
Mfrp A G 9: 44,104,587 T334A possibly damaging Het
Miga2 A G 2: 30,368,968 H63R probably damaging Het
Mrgbp T A 2: 180,585,449 N192K probably damaging Het
Mrgpra2b A G 7: 47,464,879 I35T probably benign Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ndufaf7 A T 17: 78,937,629 K59M probably damaging Het
Necab3 T C 2: 154,546,875 S208G probably benign Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Npnt G A 3: 132,914,397 Q112* probably null Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrcam A G 12: 44,573,850 K893E probably benign Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr870 A T 9: 20,170,913 Y219* probably null Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Otoa T C 7: 121,125,439 V447A probably benign Het
Patj G A 4: 98,431,780 G428D possibly damaging Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pkn2 G A 3: 142,810,701 P555S probably benign Het
Pla2g12a A G 3: 129,894,940 E149G probably benign Het
Plec C A 15: 76,177,692 E2547* probably null Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Rab3gap1 T G 1: 127,942,486 L948R probably damaging Het
Rbsn A T 6: 92,190,019 L548Q possibly damaging Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rint1 T A 5: 23,809,843 D352E probably benign Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep G C 1: 135,283,977 A11G probably benign Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G T 1: 120,063,246 E453D probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Slain2 A G 5: 72,957,614 H396R probably damaging Het
Slc22a5 G A 11: 53,866,351 P491L probably damaging Het
Slc26a4 A G 12: 31,544,494 V285A possibly damaging Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc9a8 T C 2: 167,424,145 F14S probably benign Het
Spock3 T C 8: 63,348,977 L330P probably damaging Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Synpo2l G A 14: 20,665,819 P233S probably damaging Het
Tbc1d19 T G 5: 53,829,372 I41S probably damaging Het
Tecta G A 9: 42,391,922 T138I probably benign Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tmem241 T A 18: 12,068,312 H157L probably damaging Het
Tnfrsf25 T A 4: 152,118,304 probably null Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Traf3ip3 T A 1: 193,181,893 Q394L probably benign Het
Traf7 A G 17: 24,512,379 F228L probably damaging Het
Trhr A G 15: 44,197,153 E23G probably damaging Het
Trim59 T C 3: 69,036,853 T385A probably benign Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Tubgcp2 T C 7: 139,998,055 T779A probably benign Het
Tusc2 A T 9: 107,564,631 I68F probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Usp24 A G 4: 106,360,421 N447S possibly damaging Het
Usp42 T C 5: 143,714,626 D1214G probably damaging Het
Vmn2r73 T C 7: 85,857,878 Y742C probably damaging Het
Wdfy4 A T 14: 33,096,005 S1473T possibly damaging Het
Zan C A 5: 137,415,018 probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zfyve9 A C 4: 108,718,501 V461G possibly damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63737771 splice site probably benign
IGL01890:Fastkd2 APN 1 63732161 missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63747999 missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63737924 splice site probably benign
IGL03208:Fastkd2 APN 1 63739206 missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63732028 missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63752400 missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63737811 missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63752340 missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63747955 splice site probably benign
R1468:Fastkd2 UTSW 1 63732226 unclassified probably benign
R1579:Fastkd2 UTSW 1 63745887 missense probably null 0.00
R3937:Fastkd2 UTSW 1 63737836 missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63735809 intron probably benign
R4473:Fastkd2 UTSW 1 63731674 missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63745886 missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63749896 intron probably benign
R5176:Fastkd2 UTSW 1 63731439 unclassified probably benign
R5478:Fastkd2 UTSW 1 63739186 missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63739310 missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63731794 missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63731873 missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63731850 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTGCTGATGACATCCCCGTTGGAG -3'
(R):5'- CCAGGCTGAGTAGAAGCTGATTCAC -3'

Sequencing Primer
(F):5'- CTTTCCTCCGTAGAAAGTGAAGAC -3'
(R):5'- ATGTGACTGCTCCCCTGG -3'
Posted On2014-05-23