Incidental Mutation 'R0085:Mgat4b'
ID19864
Institutional Source Beutler Lab
Gene Symbol Mgat4b
Ensembl Gene ENSMUSG00000036620
Gene Namemannoside acetylglucosaminyltransferase 4, isoenzyme B
Synonyms
MMRRC Submission 038372-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0085 (G1)
Quality Score203
Status Validated
Chromosome11
Chromosomal Location50210890-50235103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50230999 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 116 (H116Y)
Ref Sequence ENSEMBL: ENSMUSP00000119786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041725] [ENSMUST00000147468]
Predicted Effect probably benign
Transcript: ENSMUST00000041725
AA Change: H108Y

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043346
Gene: ENSMUSG00000036620
AA Change: H108Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_transf_54 98 387 6.6e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133714
Predicted Effect possibly damaging
Transcript: ENSMUST00000147468
AA Change: H116Y

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect unknown
Transcript: ENSMUST00000151803
AA Change: H55Y
SMART Domains Protein: ENSMUSP00000116802
Gene: ENSMUSG00000036620
AA Change: H55Y

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 46 252 1.9e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185146
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme A, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1,4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed targeted allele are viable and do not display any gross physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,711,739 S583R probably damaging Het
Acad12 A G 5: 121,604,294 I417T possibly damaging Het
Adcy9 T C 16: 4,288,224 T1009A probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baat T C 4: 49,490,425 probably benign Het
Bpi T A 2: 158,273,152 L311* probably null Het
Brd2 A C 17: 34,113,259 F294L probably damaging Het
Carmil1 T A 13: 24,025,867 E804D probably benign Het
Cd209g A T 8: 4,134,785 probably benign Het
Cfi A G 3: 129,874,986 I554V probably benign Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Dst T C 1: 34,229,187 S2897P probably damaging Het
Efcab7 T C 4: 99,904,680 probably benign Het
Fbxo2 T C 4: 148,164,910 probably null Het
Fgfr2 C A 7: 130,196,263 R400L probably damaging Het
Hsd17b14 T C 7: 45,556,410 probably benign Het
Il23r T C 6: 67,486,222 N96D probably damaging Het
Ints13 T A 6: 146,574,787 probably benign Het
Lig1 A G 7: 13,307,570 I776V possibly damaging Het
Madd T C 2: 91,162,738 I997V probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo5b A C 18: 74,701,680 D937A probably benign Het
Nox3 T C 17: 3,635,281 N584S probably benign Het
Ogfr A G 2: 180,591,037 probably null Het
Olfr1341 T C 4: 118,709,881 V158A probably benign Het
Olfr741 T A 14: 50,486,334 M292K probably benign Het
Olfr904 T C 9: 38,464,662 I207T probably benign Het
Osbpl6 G T 2: 76,593,414 V728F probably benign Het
Picalm T A 7: 90,182,317 S453T probably benign Het
Piezo1 A G 8: 122,501,615 L310P probably damaging Het
Pitrm1 C T 13: 6,549,568 probably benign Het
Pkd1 T C 17: 24,586,223 F3250L probably damaging Het
Plekha4 C T 7: 45,543,949 R376* probably null Het
Pnmal2 A T 7: 16,945,549 S153C unknown Het
Rp1l1 C T 14: 64,022,295 R129W probably damaging Het
Ryr3 A G 2: 112,859,763 V1147A probably damaging Het
Sema3d G A 5: 12,570,986 V520I probably benign Het
Sgsm1 A G 5: 113,279,270 probably benign Het
Slc13a2 A G 11: 78,406,868 V58A probably damaging Het
Slc1a4 A G 11: 20,304,510 probably benign Het
Slc4a10 G A 2: 62,244,346 probably benign Het
Tab1 G T 15: 80,155,893 A305S probably benign Het
Tmem30a T A 9: 79,771,294 T327S probably benign Het
Tpr A C 1: 150,417,413 E863A possibly damaging Het
Upk3bl A G 5: 136,060,115 N161D probably benign Het
Ush1c T A 7: 46,225,555 I131F probably damaging Het
Wdfy4 C A 14: 33,078,243 R1975S possibly damaging Het
Zbtb18 C T 1: 177,447,935 A287V probably benign Het
Zfp712 T C 13: 67,041,192 T424A probably benign Het
Zfp791 G T 8: 85,112,233 Y56* probably null Het
Other mutations in Mgat4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01628:Mgat4b APN 11 50233309 missense probably benign 0.01
IGL01980:Mgat4b APN 11 50230713 missense probably damaging 1.00
IGL02533:Mgat4b APN 11 50233552 missense probably damaging 0.99
IGL02729:Mgat4b APN 11 50233309 missense probably benign 0.01
IGL02888:Mgat4b APN 11 50232332 missense probably damaging 1.00
IGL03369:Mgat4b APN 11 50234109 missense possibly damaging 0.79
R0136:Mgat4b UTSW 11 50231081 missense possibly damaging 0.91
R0394:Mgat4b UTSW 11 50230919 intron probably null
R0631:Mgat4b UTSW 11 50230763 missense probably damaging 1.00
R0657:Mgat4b UTSW 11 50231081 missense possibly damaging 0.91
R3932:Mgat4b UTSW 11 50233338 missense possibly damaging 0.70
R4419:Mgat4b UTSW 11 50232986 missense probably damaging 0.99
R4816:Mgat4b UTSW 11 50211021 missense probably benign 0.01
R6315:Mgat4b UTSW 11 50231764 missense probably damaging 1.00
R6677:Mgat4b UTSW 11 50233071 unclassified probably null
R6786:Mgat4b UTSW 11 50230698 missense probably damaging 1.00
R7053:Mgat4b UTSW 11 50233540 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACATTTACCAGCGCGAGTTCC -3'
(R):5'- AGCGAGTGCAATGTGTCAGTCAAG -3'

Sequencing Primer
(F):5'- CTCCAAGGAGCTAAACCTGGTG -3'
(R):5'- TACGCTCGGAATGCCCATC -3'
Posted On2013-04-11