Incidental Mutation 'R0085:Pitrm1'
ID19866
Institutional Source Beutler Lab
Gene Symbol Pitrm1
Ensembl Gene ENSMUSG00000021193
Gene Namepitrilysin metallepetidase 1
SynonymsNtup1, PreP, 2310012C15Rik, MP-1
MMRRC Submission 038372-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0085 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location6548149-6580515 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 6549568 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021611] [ENSMUST00000221911] [ENSMUST00000222485]
Predicted Effect probably benign
Transcript: ENSMUST00000021611
SMART Domains Protein: ENSMUSP00000021611
Gene: ENSMUSG00000021193

DomainStartEndE-ValueType
Pfam:Peptidase_M16 93 188 1.8e-7 PFAM
Pfam:Peptidase_M16_C 244 431 4.7e-27 PFAM
M16C_associated 504 752 2.8e-114 SMART
Pfam:Peptidase_M16_C 771 958 2.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220454
Predicted Effect probably benign
Transcript: ENSMUST00000221120
Predicted Effect probably benign
Transcript: ENSMUST00000221911
Predicted Effect probably benign
Transcript: ENSMUST00000222485
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ATP-dependent metalloprotease that degrades post-cleavage mitochondrial transit peptides. The encoded protein binds zinc and can also degrade amyloid beta A4 protein, suggesting a possible role in Alzheimer's disease. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show complete preweaning lethality. Heterozygotes show progressive ataxia, neurodegeneration, and accumulation of amyloid beta deposits. Mitochondria show impaired degradation rate of amyloid beta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,711,739 S583R probably damaging Het
Acad12 A G 5: 121,604,294 I417T possibly damaging Het
Adcy9 T C 16: 4,288,224 T1009A probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baat T C 4: 49,490,425 probably benign Het
Bpi T A 2: 158,273,152 L311* probably null Het
Brd2 A C 17: 34,113,259 F294L probably damaging Het
Carmil1 T A 13: 24,025,867 E804D probably benign Het
Cd209g A T 8: 4,134,785 probably benign Het
Cfi A G 3: 129,874,986 I554V probably benign Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Dst T C 1: 34,229,187 S2897P probably damaging Het
Efcab7 T C 4: 99,904,680 probably benign Het
Fbxo2 T C 4: 148,164,910 probably null Het
Fgfr2 C A 7: 130,196,263 R400L probably damaging Het
Hsd17b14 T C 7: 45,556,410 probably benign Het
Il23r T C 6: 67,486,222 N96D probably damaging Het
Ints13 T A 6: 146,574,787 probably benign Het
Lig1 A G 7: 13,307,570 I776V possibly damaging Het
Madd T C 2: 91,162,738 I997V probably benign Het
Mgat4b C T 11: 50,230,999 H116Y possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo5b A C 18: 74,701,680 D937A probably benign Het
Nox3 T C 17: 3,635,281 N584S probably benign Het
Ogfr A G 2: 180,591,037 probably null Het
Olfr1341 T C 4: 118,709,881 V158A probably benign Het
Olfr741 T A 14: 50,486,334 M292K probably benign Het
Olfr904 T C 9: 38,464,662 I207T probably benign Het
Osbpl6 G T 2: 76,593,414 V728F probably benign Het
Picalm T A 7: 90,182,317 S453T probably benign Het
Piezo1 A G 8: 122,501,615 L310P probably damaging Het
Pkd1 T C 17: 24,586,223 F3250L probably damaging Het
Plekha4 C T 7: 45,543,949 R376* probably null Het
Pnmal2 A T 7: 16,945,549 S153C unknown Het
Rp1l1 C T 14: 64,022,295 R129W probably damaging Het
Ryr3 A G 2: 112,859,763 V1147A probably damaging Het
Sema3d G A 5: 12,570,986 V520I probably benign Het
Sgsm1 A G 5: 113,279,270 probably benign Het
Slc13a2 A G 11: 78,406,868 V58A probably damaging Het
Slc1a4 A G 11: 20,304,510 probably benign Het
Slc4a10 G A 2: 62,244,346 probably benign Het
Tab1 G T 15: 80,155,893 A305S probably benign Het
Tmem30a T A 9: 79,771,294 T327S probably benign Het
Tpr A C 1: 150,417,413 E863A possibly damaging Het
Upk3bl A G 5: 136,060,115 N161D probably benign Het
Ush1c T A 7: 46,225,555 I131F probably benign Het
Wdfy4 C A 14: 33,078,243 R1975S possibly damaging Het
Zbtb18 C T 1: 177,447,935 A287V probably benign Het
Zfp712 T C 13: 67,041,192 T424A probably benign Het
Zfp791 G T 8: 85,112,233 Y56* probably null Het
Other mutations in Pitrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pitrm1 APN 13 6568666 missense probably damaging 1.00
IGL01148:Pitrm1 APN 13 6573105 missense probably benign
IGL01408:Pitrm1 APN 13 6573042 missense probably damaging 1.00
IGL01557:Pitrm1 APN 13 6552684 missense probably benign 0.37
IGL01803:Pitrm1 APN 13 6579435 missense probably benign 0.00
IGL02111:Pitrm1 APN 13 6573145 missense probably benign 0.45
IGL02217:Pitrm1 APN 13 6567341 splice site probably benign
IGL02539:Pitrm1 APN 13 6568756 missense probably benign 0.26
IGL02935:Pitrm1 APN 13 6553264 missense probably damaging 1.00
IGL03028:Pitrm1 APN 13 6574393 missense probably benign 0.00
IGL03112:Pitrm1 APN 13 6565008 missense probably benign 0.10
FR4737:Pitrm1 UTSW 13 6560596 critical splice acceptor site probably benign
FR4976:Pitrm1 UTSW 13 6560596 critical splice acceptor site probably benign
R0078:Pitrm1 UTSW 13 6575032 missense probably damaging 0.99
R0089:Pitrm1 UTSW 13 6555639 missense probably damaging 1.00
R0234:Pitrm1 UTSW 13 6575079 nonsense probably null
R0234:Pitrm1 UTSW 13 6575079 nonsense probably null
R0478:Pitrm1 UTSW 13 6559395 missense probably damaging 0.99
R0496:Pitrm1 UTSW 13 6568714 missense probably damaging 1.00
R0781:Pitrm1 UTSW 13 6558244 missense probably benign 0.03
R1061:Pitrm1 UTSW 13 6555575 missense probably damaging 0.99
R1110:Pitrm1 UTSW 13 6558244 missense probably benign 0.03
R1170:Pitrm1 UTSW 13 6552744 splice site probably benign
R1373:Pitrm1 UTSW 13 6570700 missense probably benign 0.03
R1563:Pitrm1 UTSW 13 6563470 missense possibly damaging 0.85
R1897:Pitrm1 UTSW 13 6560095 missense possibly damaging 0.78
R1985:Pitrm1 UTSW 13 6558184 missense probably damaging 1.00
R2075:Pitrm1 UTSW 13 6555383 missense probably damaging 1.00
R2114:Pitrm1 UTSW 13 6557773 missense probably damaging 1.00
R2115:Pitrm1 UTSW 13 6557773 missense probably damaging 1.00
R2206:Pitrm1 UTSW 13 6569291 missense probably damaging 1.00
R2207:Pitrm1 UTSW 13 6569291 missense probably damaging 1.00
R2260:Pitrm1 UTSW 13 6560125 missense probably damaging 1.00
R2568:Pitrm1 UTSW 13 6575092 missense probably benign 0.15
R3409:Pitrm1 UTSW 13 6578481 missense possibly damaging 0.81
R3756:Pitrm1 UTSW 13 6558235 missense probably damaging 1.00
R4020:Pitrm1 UTSW 13 6556687 missense probably damaging 1.00
R4327:Pitrm1 UTSW 13 6579773 utr 3 prime probably benign
R4540:Pitrm1 UTSW 13 6555470 critical splice donor site probably null
R4579:Pitrm1 UTSW 13 6558225 missense probably benign 0.05
R4659:Pitrm1 UTSW 13 6553182 missense probably benign 0.37
R4685:Pitrm1 UTSW 13 6556542 missense probably benign 0.00
R4888:Pitrm1 UTSW 13 6578560 missense probably damaging 1.00
R5072:Pitrm1 UTSW 13 6553190 missense probably damaging 1.00
R5159:Pitrm1 UTSW 13 6567471 missense probably benign 0.00
R5383:Pitrm1 UTSW 13 6577432 missense probably damaging 1.00
R5470:Pitrm1 UTSW 13 6553270 missense probably benign 0.07
R5606:Pitrm1 UTSW 13 6560065 missense probably damaging 1.00
R6224:Pitrm1 UTSW 13 6565054 missense probably damaging 1.00
R6302:Pitrm1 UTSW 13 6560061 missense probably damaging 0.99
R6898:Pitrm1 UTSW 13 6555459 missense probably damaging 1.00
R7021:Pitrm1 UTSW 13 6578557 missense probably damaging 0.99
R7249:Pitrm1 UTSW 13 6560125 missense probably damaging 1.00
R7256:Pitrm1 UTSW 13 6556597 missense probably damaging 1.00
R7363:Pitrm1 UTSW 13 6569351 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCAGATTGCCCTGACAAGATTG -3'
(R):5'- TTCATCATAGGCTGCCTGGAGCAC -3'

Sequencing Primer
(F):5'- TGCCCTGACAAGATTGTAACTC -3'
(R):5'- TGTCCAGAAGCTTACCAGGTC -3'
Posted On2013-04-11