Incidental Mutation 'R0085:Rp1l1'
ID19869
Institutional Source Beutler Lab
Gene Symbol Rp1l1
Ensembl Gene ENSMUSG00000046049
Gene Nameretinitis pigmentosa 1 homolog like 1
SynonymsDcdc4, Rp1hl1
MMRRC Submission 038372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R0085 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location63992506-64035025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64022295 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 129 (R129W)
Ref Sequence ENSEMBL: ENSMUSP00000055449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058229]
Predicted Effect probably damaging
Transcript: ENSMUST00000058229
AA Change: R129W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: R129W

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
DCX 37 121 1.58e-13 SMART
DCX 155 239 1e-15 SMART
low complexity region 709 728 N/A INTRINSIC
low complexity region 870 884 N/A INTRINSIC
low complexity region 1159 1177 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1612 1618 N/A INTRINSIC
low complexity region 1642 1652 N/A INTRINSIC
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,711,739 S583R probably damaging Het
Acad12 A G 5: 121,604,294 I417T possibly damaging Het
Adcy9 T C 16: 4,288,224 T1009A probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baat T C 4: 49,490,425 probably benign Het
Bpi T A 2: 158,273,152 L311* probably null Het
Brd2 A C 17: 34,113,259 F294L probably damaging Het
Carmil1 T A 13: 24,025,867 E804D probably benign Het
Cd209g A T 8: 4,134,785 probably benign Het
Cfi A G 3: 129,874,986 I554V probably benign Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Dst T C 1: 34,229,187 S2897P probably damaging Het
Efcab7 T C 4: 99,904,680 probably benign Het
Fbxo2 T C 4: 148,164,910 probably null Het
Fgfr2 C A 7: 130,196,263 R400L probably damaging Het
Hsd17b14 T C 7: 45,556,410 probably benign Het
Il23r T C 6: 67,486,222 N96D probably damaging Het
Ints13 T A 6: 146,574,787 probably benign Het
Lig1 A G 7: 13,307,570 I776V possibly damaging Het
Madd T C 2: 91,162,738 I997V probably benign Het
Mgat4b C T 11: 50,230,999 H116Y possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo5b A C 18: 74,701,680 D937A probably benign Het
Nox3 T C 17: 3,635,281 N584S probably benign Het
Ogfr A G 2: 180,591,037 probably null Het
Olfr1341 T C 4: 118,709,881 V158A probably benign Het
Olfr741 T A 14: 50,486,334 M292K probably benign Het
Olfr904 T C 9: 38,464,662 I207T probably benign Het
Osbpl6 G T 2: 76,593,414 V728F probably benign Het
Picalm T A 7: 90,182,317 S453T probably benign Het
Piezo1 A G 8: 122,501,615 L310P probably damaging Het
Pitrm1 C T 13: 6,549,568 probably benign Het
Pkd1 T C 17: 24,586,223 F3250L probably damaging Het
Plekha4 C T 7: 45,543,949 R376* probably null Het
Pnmal2 A T 7: 16,945,549 S153C unknown Het
Ryr3 A G 2: 112,859,763 V1147A probably damaging Het
Sema3d G A 5: 12,570,986 V520I probably benign Het
Sgsm1 A G 5: 113,279,270 probably benign Het
Slc13a2 A G 11: 78,406,868 V58A probably damaging Het
Slc1a4 A G 11: 20,304,510 probably benign Het
Slc4a10 G A 2: 62,244,346 probably benign Het
Tab1 G T 15: 80,155,893 A305S probably benign Het
Tmem30a T A 9: 79,771,294 T327S probably benign Het
Tpr A C 1: 150,417,413 E863A possibly damaging Het
Upk3bl A G 5: 136,060,115 N161D probably benign Het
Ush1c T A 7: 46,225,555 I131F probably damaging Het
Wdfy4 C A 14: 33,078,243 R1975S possibly damaging Het
Zbtb18 C T 1: 177,447,935 A287V probably benign Het
Zfp712 T C 13: 67,041,192 T424A probably benign Het
Zfp791 G T 8: 85,112,233 Y56* probably null Het
Other mutations in Rp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rp1l1 APN 14 64028725 missense probably benign 0.01
IGL02063:Rp1l1 APN 14 64029536 missense probably damaging 0.99
IGL02132:Rp1l1 APN 14 64028810 missense probably benign
IGL02430:Rp1l1 APN 14 64029286 missense probably benign 0.00
IGL02977:Rp1l1 APN 14 64028150 missense probably benign 0.01
IGL03213:Rp1l1 APN 14 64028415 missense probably damaging 0.98
IGL03346:Rp1l1 APN 14 64029440 missense probably benign
R0347:Rp1l1 UTSW 14 64030804 nonsense probably null
R0362:Rp1l1 UTSW 14 64031066 nonsense probably null
R0369:Rp1l1 UTSW 14 64029388 missense possibly damaging 0.84
R0538:Rp1l1 UTSW 14 64022092 missense probably damaging 1.00
R0544:Rp1l1 UTSW 14 64032066 missense probably benign 0.00
R0780:Rp1l1 UTSW 14 64030351 missense possibly damaging 0.94
R0944:Rp1l1 UTSW 14 64032232 missense probably benign 0.05
R1051:Rp1l1 UTSW 14 64032535 missense probably damaging 0.99
R1126:Rp1l1 UTSW 14 64030469 missense probably damaging 1.00
R1450:Rp1l1 UTSW 14 64028150 missense probably benign 0.01
R1483:Rp1l1 UTSW 14 64029047 missense possibly damaging 0.76
R1508:Rp1l1 UTSW 14 64030892 missense possibly damaging 0.83
R1553:Rp1l1 UTSW 14 64031894 missense probably benign 0.00
R1651:Rp1l1 UTSW 14 64030993 missense probably damaging 0.97
R1682:Rp1l1 UTSW 14 64028968 missense probably damaging 0.98
R1809:Rp1l1 UTSW 14 64027966 missense probably benign 0.18
R1885:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1887:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1898:Rp1l1 UTSW 14 64031590 missense probably benign 0.04
R1924:Rp1l1 UTSW 14 64031543 missense probably benign
R1939:Rp1l1 UTSW 14 64029593 missense probably benign
R1941:Rp1l1 UTSW 14 64022252 missense probably damaging 1.00
R2129:Rp1l1 UTSW 14 64028966 missense possibly damaging 0.93
R2363:Rp1l1 UTSW 14 64029998 missense possibly damaging 0.55
R3894:Rp1l1 UTSW 14 64029307 missense probably benign
R3974:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3975:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3976:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R4072:Rp1l1 UTSW 14 64028132 missense probably damaging 1.00
R4672:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4673:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4749:Rp1l1 UTSW 14 64029800 missense probably damaging 0.99
R4755:Rp1l1 UTSW 14 64030070 missense probably benign 0.34
R4877:Rp1l1 UTSW 14 64026171 missense probably benign 0.00
R4930:Rp1l1 UTSW 14 64032206 missense probably benign
R5039:Rp1l1 UTSW 14 64031356 missense probably benign 0.21
R5106:Rp1l1 UTSW 14 64027946 missense probably damaging 1.00
R5184:Rp1l1 UTSW 14 64030180 missense probably damaging 1.00
R5215:Rp1l1 UTSW 14 64030013 missense probably benign 0.01
R5409:Rp1l1 UTSW 14 64030621 missense probably benign 0.02
R5575:Rp1l1 UTSW 14 64030984 missense probably benign 0.23
R5696:Rp1l1 UTSW 14 64029746 missense probably damaging 0.99
R5739:Rp1l1 UTSW 14 64032170 missense probably benign 0.01
R5878:Rp1l1 UTSW 14 64028906 missense probably benign 0.09
R6133:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6134:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6135:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6428:Rp1l1 UTSW 14 64032389 missense possibly damaging 0.92
R6594:Rp1l1 UTSW 14 64031677 nonsense probably null
R6736:Rp1l1 UTSW 14 64029724 missense possibly damaging 0.93
R6800:Rp1l1 UTSW 14 64031150 missense possibly damaging 0.92
R6848:Rp1l1 UTSW 14 64028218 missense possibly damaging 0.79
R6878:Rp1l1 UTSW 14 64031852 missense probably benign 0.00
R6922:Rp1l1 UTSW 14 64030385 missense possibly damaging 0.93
X0057:Rp1l1 UTSW 14 64030040 missense probably benign 0.14
X0063:Rp1l1 UTSW 14 64029223 missense probably damaging 0.98
Z1088:Rp1l1 UTSW 14 64028758 missense possibly damaging 0.80
Z1088:Rp1l1 UTSW 14 64030378 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCTTCCTCAAGCGAGGTGATCC -3'
(R):5'- GTGACTGAGAACCACTGTCTGCTG -3'

Sequencing Primer
(F):5'- CTTCAGCTCCCTAATGGATGAG -3'
(R):5'- TGTTTCTGGAGCTTCATGCC -3'
Posted On2013-04-11