Incidental Mutation 'R0085:Tab1'
ID19870
Institutional Source Beutler Lab
Gene Symbol Tab1
Ensembl Gene ENSMUSG00000022414
Gene NameTGF-beta activated kinase 1/MAP3K7 binding protein 1
Synonyms2310012M03Rik, Map3k7ip1, b2b449Clo, Tak1-binding protein 1
MMRRC Submission 038372-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0085 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80133127-80161707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80155893 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 305 (A305S)
Ref Sequence ENSEMBL: ENSMUSP00000023050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023050]
PDB Structure
Structural basis of autoactivation of p38 alpha induced by TAB1 (Monoclinic crystal form) [X-RAY DIFFRACTION]
Structural basis of autoactivation of p38 alpha induced by TAB1 (Tetragonal crystal form) [X-RAY DIFFRACTION]
Structural basis of autoactivation of p38 alpha induced by TAB1 (Tetragonal crystal form with bound sulphate) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000023050
AA Change: A305S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000023050
Gene: ENSMUSG00000022414
AA Change: A305S

DomainStartEndE-ValueType
PP2Cc 26 363 7.45e-40 SMART
low complexity region 397 408 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
PDB:4L3P|A 466 502 6e-17 PDB
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a regulator of the MAP kinase kinase kinase MAP3K7/TAK1, which is known to mediate various intracellular signaling pathways, such as those induced by TGF beta, interleukin 1, and WNT-1. This protein interacts and thus activates TAK1 kinase. It has been shown that the C-terminal portion of this protein is sufficient for binding and activation of TAK1, while a portion of the N-terminus acts as a dominant-negative inhibitor of TGF beta, suggesting that this protein may function as a mediator between TGF beta receptors and TAK1. This protein can also interact with and activate the mitogen-activated protein kinase 14 (MAPK14/p38alpha), and thus represents an alternative activation pathway, in addition to the MAPKK pathways, which contributes to the biological responses of MAPK14 to various stimuli. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant fetuses exhibit edema, hemorrhaging, cardiovascular and pulmonary dysmorphogenesis, and die in the late stages of gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,711,739 S583R probably damaging Het
Acad12 A G 5: 121,604,294 I417T possibly damaging Het
Adcy9 T C 16: 4,288,224 T1009A probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baat T C 4: 49,490,425 probably benign Het
Bpi T A 2: 158,273,152 L311* probably null Het
Brd2 A C 17: 34,113,259 F294L probably damaging Het
Carmil1 T A 13: 24,025,867 E804D probably benign Het
Cd209g A T 8: 4,134,785 probably benign Het
Cfi A G 3: 129,874,986 I554V probably benign Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Dst T C 1: 34,229,187 S2897P probably damaging Het
Efcab7 T C 4: 99,904,680 probably benign Het
Fbxo2 T C 4: 148,164,910 probably null Het
Fgfr2 C A 7: 130,196,263 R400L probably damaging Het
Hsd17b14 T C 7: 45,556,410 probably benign Het
Il23r T C 6: 67,486,222 N96D probably damaging Het
Ints13 T A 6: 146,574,787 probably benign Het
Lig1 A G 7: 13,307,570 I776V possibly damaging Het
Madd T C 2: 91,162,738 I997V probably benign Het
Mgat4b C T 11: 50,230,999 H116Y possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo5b A C 18: 74,701,680 D937A probably benign Het
Nox3 T C 17: 3,635,281 N584S probably benign Het
Ogfr A G 2: 180,591,037 probably null Het
Olfr1341 T C 4: 118,709,881 V158A probably benign Het
Olfr741 T A 14: 50,486,334 M292K probably benign Het
Olfr904 T C 9: 38,464,662 I207T probably benign Het
Osbpl6 G T 2: 76,593,414 V728F probably benign Het
Picalm T A 7: 90,182,317 S453T probably benign Het
Piezo1 A G 8: 122,501,615 L310P probably damaging Het
Pitrm1 C T 13: 6,549,568 probably benign Het
Pkd1 T C 17: 24,586,223 F3250L probably damaging Het
Plekha4 C T 7: 45,543,949 R376* probably null Het
Pnmal2 A T 7: 16,945,549 S153C unknown Het
Rp1l1 C T 14: 64,022,295 R129W probably damaging Het
Ryr3 A G 2: 112,859,763 V1147A probably damaging Het
Sema3d G A 5: 12,570,986 V520I probably benign Het
Sgsm1 A G 5: 113,279,270 probably benign Het
Slc13a2 A G 11: 78,406,868 V58A probably damaging Het
Slc1a4 A G 11: 20,304,510 probably benign Het
Slc4a10 G A 2: 62,244,346 probably benign Het
Tmem30a T A 9: 79,771,294 T327S probably benign Het
Tpr A C 1: 150,417,413 E863A possibly damaging Het
Upk3bl A G 5: 136,060,115 N161D probably benign Het
Ush1c T A 7: 46,225,555 I131F probably damaging Het
Wdfy4 C A 14: 33,078,243 R1975S possibly damaging Het
Zbtb18 C T 1: 177,447,935 A287V probably benign Het
Zfp712 T C 13: 67,041,192 T424A probably benign Het
Zfp791 G T 8: 85,112,233 Y56* probably null Het
Other mutations in Tab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Tab1 APN 15 80148830 missense probably benign 0.05
memento UTSW 15 80153668 missense probably damaging 0.96
Memoir UTSW 15 80153740 missense probably damaging 1.00
R1341:Tab1 UTSW 15 80160114 missense possibly damaging 0.86
R1835:Tab1 UTSW 15 80148296 missense probably benign 0.42
R1907:Tab1 UTSW 15 80153668 missense probably damaging 0.96
R3113:Tab1 UTSW 15 80148260 missense probably benign 0.23
R3943:Tab1 UTSW 15 80153740 missense probably damaging 1.00
R3944:Tab1 UTSW 15 80153740 missense probably damaging 1.00
R4845:Tab1 UTSW 15 80152763 missense probably damaging 1.00
R5345:Tab1 UTSW 15 80149813 missense possibly damaging 0.48
R5696:Tab1 UTSW 15 80148729 nonsense probably null
R6223:Tab1 UTSW 15 80148263 missense probably damaging 1.00
R6242:Tab1 UTSW 15 80155770 nonsense probably null
R6561:Tab1 UTSW 15 80148830 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTCACCTCAGCAGAAGCAGTGAC -3'
(R):5'- TCCAGCAGTCTCAGTAGGCAGAAC -3'

Sequencing Primer
(F):5'- GGGGTCTTTTTCCACACAAAGC -3'
(R):5'- GGAAGAGTTGTATCCTCCCCATAATC -3'
Posted On2013-04-11