Incidental Mutation 'R0085:Brd2'
ID19872
Institutional Source Beutler Lab
Gene Symbol Brd2
Ensembl Gene ENSMUSG00000024335
Gene Namebromodomain containing 2
SynonymsFrg-1, Fsrg1, D17H6S113E, Ring3, Rnf3
MMRRC Submission 038372-MU
Accession Numbers

Genbank: NM_010238, NM_001025387; MGI: 99495

 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0085 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34112023-34122634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 34113259 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 294 (F294L)
Ref Sequence ENSEMBL: ENSMUSP00000092990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025193] [ENSMUST00000095347] [ENSMUST00000114242] [ENSMUST00000151986] [ENSMUST00000154232]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025193
AA Change: F686L

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025193
Gene: ENSMUSG00000024335
AA Change: F686L

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
coiled coil region 486 537 N/A INTRINSIC
low complexity region 542 560 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
PDB:2JNS|A 635 712 3e-37 PDB
coiled coil region 721 750 N/A INTRINSIC
low complexity region 772 797 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095347
AA Change: F294L

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092990
Gene: ENSMUSG00000024335
AA Change: F294L

DomainStartEndE-ValueType
BROMO 25 135 1.3e-45 SMART
low complexity region 210 230 N/A INTRINSIC
low complexity region 238 244 N/A INTRINSIC
low complexity region 248 258 N/A INTRINSIC
BROMO 299 408 6.8e-50 SMART
coiled coil region 440 491 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 537 547 N/A INTRINSIC
PDB:2JNS|A 589 666 2e-37 PDB
coiled coil region 675 704 N/A INTRINSIC
low complexity region 726 751 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114242
AA Change: F686L

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109880
Gene: ENSMUSG00000024335
AA Change: F686L

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
coiled coil region 486 537 N/A INTRINSIC
low complexity region 542 560 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
Pfam:BET 639 703 7.4e-35 PFAM
coiled coil region 721 750 N/A INTRINSIC
low complexity region 772 797 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148143
Predicted Effect probably benign
Transcript: ENSMUST00000151986
SMART Domains Protein: ENSMUSP00000117359
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154232
SMART Domains Protein: ENSMUSP00000128835
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 50 71 N/A INTRINSIC
Blast:BROMO 72 110 4e-21 BLAST
PDB:3AQA|C 72 110 2e-22 PDB
SCOP:d1f68a_ 76 103 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155286
Predicted Effect probably benign
Transcript: ENSMUST00000173032
SMART Domains Protein: ENSMUSP00000134608
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
Pfam:Bromodomain 1 43 1.4e-6 PFAM
coiled coil region 73 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173204
Meta Mutation Damage Score 0.386 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with decreased embryo size, decreased cell proliferation, a delay in the cell cycle, and increased cell death. Heterozygous mice also display decreased cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, other(2) Gene trapped(14)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,711,739 S583R probably damaging Het
Acad12 A G 5: 121,604,294 I417T possibly damaging Het
Adcy9 T C 16: 4,288,224 T1009A probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baat T C 4: 49,490,425 probably benign Het
Bpi T A 2: 158,273,152 L311* probably null Het
Carmil1 T A 13: 24,025,867 E804D probably benign Het
Cd209g A T 8: 4,134,785 probably benign Het
Cfi A G 3: 129,874,986 I554V probably benign Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Dst T C 1: 34,229,187 S2897P probably damaging Het
Efcab7 T C 4: 99,904,680 probably benign Het
Fbxo2 T C 4: 148,164,910 probably null Het
Fgfr2 C A 7: 130,196,263 R400L probably damaging Het
Hsd17b14 T C 7: 45,556,410 probably benign Het
Il23r T C 6: 67,486,222 N96D probably damaging Het
Ints13 T A 6: 146,574,787 probably benign Het
Lig1 A G 7: 13,307,570 I776V possibly damaging Het
Madd T C 2: 91,162,738 I997V probably benign Het
Mgat4b C T 11: 50,230,999 H116Y possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo5b A C 18: 74,701,680 D937A probably benign Het
Nox3 T C 17: 3,635,281 N584S probably benign Het
Ogfr A G 2: 180,591,037 probably null Het
Olfr1341 T C 4: 118,709,881 V158A probably benign Het
Olfr741 T A 14: 50,486,334 M292K probably benign Het
Olfr904 T C 9: 38,464,662 I207T probably benign Het
Osbpl6 G T 2: 76,593,414 V728F probably benign Het
Picalm T A 7: 90,182,317 S453T probably benign Het
Piezo1 A G 8: 122,501,615 L310P probably damaging Het
Pitrm1 C T 13: 6,549,568 probably benign Het
Pkd1 T C 17: 24,586,223 F3250L probably damaging Het
Plekha4 C T 7: 45,543,949 R376* probably null Het
Pnmal2 A T 7: 16,945,549 S153C unknown Het
Rp1l1 C T 14: 64,022,295 R129W probably damaging Het
Ryr3 A G 2: 112,859,763 V1147A probably damaging Het
Sema3d G A 5: 12,570,986 V520I probably benign Het
Sgsm1 A G 5: 113,279,270 probably benign Het
Slc13a2 A G 11: 78,406,868 V58A probably damaging Het
Slc1a4 A G 11: 20,304,510 probably benign Het
Slc4a10 G A 2: 62,244,346 probably benign Het
Tab1 G T 15: 80,155,893 A305S probably benign Het
Tmem30a T A 9: 79,771,294 T327S probably benign Het
Tpr A C 1: 150,417,413 E863A possibly damaging Het
Upk3bl A G 5: 136,060,115 N161D probably benign Het
Ush1c T A 7: 46,225,555 I131F probably damaging Het
Wdfy4 C A 14: 33,078,243 R1975S possibly damaging Het
Zbtb18 C T 1: 177,447,935 A287V probably benign Het
Zfp712 T C 13: 67,041,192 T424A probably benign Het
Zfp791 G T 8: 85,112,233 Y56* probably null Het
Other mutations in Brd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Brd2 APN 17 34114423 missense probably damaging 1.00
IGL01589:Brd2 APN 17 34117042 missense probably damaging 1.00
IGL01724:Brd2 APN 17 34117002 missense probably damaging 1.00
IGL01724:Brd2 APN 17 34117001 missense probably damaging 1.00
IGL02043:Brd2 APN 17 34112616 unclassified probably benign
crater UTSW 17 34113259 missense probably damaging 0.96
FR4449:Brd2 UTSW 17 34116336 unclassified probably benign
FR4548:Brd2 UTSW 17 34116336 unclassified probably benign
R0497:Brd2 UTSW 17 34114360 missense probably damaging 1.00
R0879:Brd2 UTSW 17 34113446 missense probably benign 0.03
R1150:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R1152:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R1280:Brd2 UTSW 17 34114150 missense possibly damaging 0.91
R1426:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R2247:Brd2 UTSW 17 34114415 missense probably damaging 1.00
R3737:Brd2 UTSW 17 34117080 missense probably benign 0.10
R5286:Brd2 UTSW 17 34115231 missense probably damaging 0.97
R5673:Brd2 UTSW 17 34112607 unclassified probably benign
R6134:Brd2 UTSW 17 34113695 missense probably benign 0.00
R6318:Brd2 UTSW 17 34112898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATGCTGCTTGCCACAAAC -3'
(R):5'- AGCCAGCTTGCATGGTGTAAACTC -3'

Sequencing Primer
(F):5'- TGCTTGCCACAAACACACAC -3'
(R):5'- CCCACTGGCTATGATTCTGAGG -3'
Posted On2013-04-11