Incidental Mutation 'R1730:Fam72a'
Institutional Source Beutler Lab
Gene Symbol Fam72a
Ensembl Gene ENSMUSG00000055184
Gene Namefamily with sequence similarity 72, member A
SynonymsP17, 2700049P18Rik
MMRRC Submission 039762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R1730 (G1)
Quality Score225
Status Not validated
Chromosomal Location131527903-131539872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131538895 bp
Amino Acid Change Threonine to Methionine at position 139 (T139M)
Ref Sequence ENSEMBL: ENSMUSP00000068111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068613]
Predicted Effect probably benign
Transcript: ENSMUST00000068613
AA Change: T139M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068111
Gene: ENSMUSG00000055184
AA Change: T139M

Pfam:FAM72 5 149 3.9e-84 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 204 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,919,278 I369T possibly damaging Het
Aass T C 6: 23,121,019 D82G probably damaging Het
Abi3bp G A 16: 56,668,279 V1258I possibly damaging Het
Acad11 T A 9: 104,063,882 V41E probably benign Het
Aff1 T G 5: 103,833,512 L514V probably damaging Het
Ankdd1b G T 13: 96,460,903 T7K probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Bag3 A T 7: 128,523,859 M1L possibly damaging Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Carmil1 T C 13: 24,041,689 T635A probably damaging Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cep63 T A 9: 102,618,867 I114F possibly damaging Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Cnr1 A G 4: 33,943,851 T80A possibly damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Col12a1 A C 9: 79,628,378 V2612G possibly damaging Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Cyp2c29 A T 19: 39,324,945 H295L possibly damaging Het
Cyp2c68 A T 19: 39,699,275 M426K possibly damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dsg2 G A 18: 20,591,880 V448I probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Eogt T C 6: 97,113,864 D438G probably damaging Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Etnppl A G 3: 130,620,749 T98A probably damaging Het
Eya2 G T 2: 165,687,663 G109W probably damaging Het
Fam131b T G 6: 42,318,580 Q221P possibly damaging Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Gabarap C T 11: 69,991,689 probably benign Het
Gatad2a G T 8: 69,909,936 H600N probably damaging Het
Gba2 A G 4: 43,578,242 C36R probably benign Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Gm10961 T C 3: 107,632,994 probably benign Het
Gm4847 T C 1: 166,638,339 D227G possibly damaging Het
Gpr37l1 C A 1: 135,161,530 E266* probably null Het
Gucy1a2 A T 9: 3,634,957 N334Y probably benign Het
H2-D1 A G 17: 35,263,405 T34A probably damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcna5 A T 6: 126,533,860 I435N probably damaging Het
Kcnj5 T C 9: 32,322,192 I276V probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Klhl20 A G 1: 161,102,990 V314A possibly damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lin7b A T 7: 45,369,927 H72Q probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Map3k9 A T 12: 81,722,226 V1016E probably damaging Het
Mcam T C 9: 44,134,706 L6P probably damaging Het
Mgam A G 6: 40,664,860 H549R possibly damaging Het
Mrc1 T C 2: 14,327,844 V1285A probably benign Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Myh7b A G 2: 155,625,672 D739G possibly damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Nfkbib A T 7: 28,762,055 Y86N probably damaging Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrip1 G T 16: 76,292,890 T593K probably benign Het
Obscn A G 11: 59,073,633 Y726H probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfml2b G A 1: 170,681,789 G569S probably damaging Het
Olfr1012 T A 2: 85,760,242 I45F possibly damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1307 T C 2: 111,945,288 H56R probably benign Het
Olfr1417 T A 19: 11,828,081 Q315L probably benign Het
Olfr371 A C 8: 85,230,848 M118L probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr924 T A 9: 38,848,972 I286K probably damaging Het
Olfr951 T C 9: 39,394,222 Y144H probably benign Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pard6g T A 18: 80,079,825 F25I probably damaging Het
Parp6 C A 9: 59,633,538 C291* probably null Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Polr2i T C 7: 30,233,068 C67R probably damaging Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptgfrn T C 3: 101,056,442 N618S possibly damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Rad17 C T 13: 100,622,806 R571Q probably damaging Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A C 1: 133,356,457 K187Q probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rims1 C T 1: 22,346,529 probably null Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sele T G 1: 164,054,623 V559G probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Setd1a T A 7: 127,785,124 Y382* probably null Het
Sipa1l2 A T 8: 125,480,141 probably null Het
Slc25a41 T C 17: 57,039,921 E10G probably benign Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Susd4 A G 1: 182,853,978 E128G probably damaging Het
Synpo2l G A 14: 20,665,819 P233S probably damaging Het
Tbc1d17 A C 7: 44,845,131 S227A probably damaging Het
Tfg G T 16: 56,712,789 N2K probably damaging Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tmem143 G A 7: 45,907,002 D144N possibly damaging Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Trim47 A G 11: 116,106,038 L630P probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttk A G 9: 83,868,592 N691S possibly damaging Het
Ttn T G 2: 76,716,992 T32237P probably damaging Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Uggt1 T C 1: 36,221,261 T158A probably benign Het
Usp9y A T Y: 1,367,093 V998D probably benign Het
Vwa5b2 C T 16: 20,600,925 P644S probably damaging Het
Wars A C 12: 108,875,741 F160C probably damaging Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfp541 A G 7: 16,077,973 T184A probably damaging Het
Zfp804b T C 5: 6,771,938 D375G probably damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Fam72a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Fam72a APN 1 131533912 missense probably benign 0.01
R0548:Fam72a UTSW 1 131533861 missense probably damaging 1.00
R0943:Fam72a UTSW 1 131528779 missense possibly damaging 0.82
R1037:Fam72a UTSW 1 131533819 missense probably damaging 1.00
R1728:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1728:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1729:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1729:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1730:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1739:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1739:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1762:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1762:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1783:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1783:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1784:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1784:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1785:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1785:Fam72a UTSW 1 131538895 missense probably benign 0.00
R2508:Fam72a UTSW 1 131528854 critical splice donor site probably null
R6589:Fam72a UTSW 1 131533816 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agttcaattcccaaaaaccacag -3'
Posted On2014-05-23