Incidental Mutation 'R1730:Obscn'
ID199255
Institutional Source Beutler Lab
Gene Symbol Obscn
Ensembl Gene ENSMUSG00000061462
Gene Nameobscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
SynonymsOTTMUSG00000005786, LOC380698
MMRRC Submission 039762-MU
Accession Numbers

Genbank: NM_001171512.1, NM_199152.2; MGI: 2681862

Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R1730 (G1)
Quality Score219
Status Not validated
Chromosome11
Chromosomal Location58994256-59136402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59073633 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 726 (Y726H)
Ref Sequence ENSEMBL: ENSMUSP00000122181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020732] [ENSMUST00000047441] [ENSMUST00000052872] [ENSMUST00000133040]
Predicted Effect probably benign
Transcript: ENSMUST00000020732
AA Change: Y3304H

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020732
Gene: ENSMUSG00000061462
AA Change: Y3304H

DomainStartEndE-ValueType
IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 876 942 4.49e-6 SMART
IGc2 968 1034 2.54e-5 SMART
IGc2 1060 1126 2.54e-5 SMART
IGc2 1152 1218 4.49e-6 SMART
IGc2 1244 1310 7.82e-6 SMART
IGc2 1336 1402 5.16e-6 SMART
IGc2 1428 1494 1.93e-5 SMART
IGc2 1520 1586 1.93e-5 SMART
IGc2 1612 1678 1.93e-5 SMART
IGc2 1704 1770 1.93e-5 SMART
IGc2 1796 1862 1.93e-5 SMART
IGc2 1888 1954 1.93e-5 SMART
IGc2 1980 2046 7.94e-7 SMART
IGc2 2072 2138 6.35e-6 SMART
IG 2158 2238 5.37e-4 SMART
IG 2248 2327 9.93e-8 SMART
IG 2338 2417 2.48e-8 SMART
IG 2427 2506 3.89e-1 SMART
IG 2516 2595 1.92e0 SMART
IG 2605 2683 6.45e-7 SMART
IG 2728 2807 1.22e-7 SMART
IGc2 2913 2979 9.93e-8 SMART
low complexity region 2981 2992 N/A INTRINSIC
IG 2996 3075 2.44e0 SMART
IGc2 3091 3157 2.1e-6 SMART
IG 3174 3255 2.86e0 SMART
IGc2 3271 3337 8.38e-6 SMART
IG 3354 3433 1.2e-6 SMART
IG 3443 3524 1.42e-3 SMART
IGc2 3540 3606 3.85e-5 SMART
IGc2 3629 3695 3.13e-5 SMART
IGc2 3718 3783 3.3e-4 SMART
IGc2 3806 3871 5.84e-5 SMART
IGc2 3894 3959 1.29e-6 SMART
IG_like 3982 4047 5.5e-1 SMART
IGc2 4054 4119 1.46e-5 SMART
IGc2 4142 4207 1.25e-4 SMART
IGc2 4230 4295 1.56e-5 SMART
IGc2 4318 4383 1.19e-5 SMART
IG_like 4400 4479 2.1e1 SMART
IGc2 4495 4560 1.93e-5 SMART
IGc2 4583 4648 3.91e-6 SMART
IG 4665 4743 1.85e-7 SMART
IG 4753 4831 1.03e-5 SMART
IGc2 4847 4912 5.08e-5 SMART
IGc2 4935 5001 5.08e-5 SMART
IGc2 5024 5090 1.11e-5 SMART
IGc2 5113 5181 6.71e-5 SMART
IG 5198 5280 2.06e-5 SMART
low complexity region 5307 5321 N/A INTRINSIC
IG 5377 5459 1.04e-1 SMART
IG 5469 5551 9.12e-7 SMART
FN3 5554 5636 2.44e-14 SMART
IG 5658 5740 3.68e-2 SMART
IQ 5900 5922 3.65e-4 SMART
IGc2 5939 6007 8.72e-4 SMART
low complexity region 6015 6031 N/A INTRINSIC
low complexity region 6032 6048 N/A INTRINSIC
low complexity region 6051 6074 N/A INTRINSIC
IGc2 6169 6237 3.25e-12 SMART
low complexity region 6250 6266 N/A INTRINSIC
IG 6296 6380 1.55e0 SMART
IGc2 6412 6485 1.82e-6 SMART
low complexity region 6599 6629 N/A INTRINSIC
SH3 6632 6695 1.22e0 SMART
Pfam:RhoGEF 6726 6904 2.8e-22 PFAM
PH 6925 7035 2.74e-11 SMART
IGc2 7055 7123 3.73e-12 SMART
IGc2 7149 7218 1.18e-14 SMART
low complexity region 7259 7273 N/A INTRINSIC
low complexity region 7274 7301 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047441
AA Change: Y3028H

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038264
Gene: ENSMUSG00000061462
AA Change: Y3028H

DomainStartEndE-ValueType
IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 876 942 2.54e-5 SMART
IGc2 968 1034 2.54e-5 SMART
IGc2 1060 1126 4.49e-6 SMART
IGc2 1152 1218 7.82e-6 SMART
IGc2 1244 1310 5.16e-6 SMART
IGc2 1336 1402 1.93e-5 SMART
IGc2 1428 1494 1.93e-5 SMART
IGc2 1520 1586 1.93e-5 SMART
IGc2 1612 1678 1.93e-5 SMART
IGc2 1704 1770 1.93e-5 SMART
IGc2 1796 1862 7.94e-7 SMART
IG 1882 1962 5.37e-4 SMART
IG 1972 2051 9.93e-8 SMART
IG 2062 2141 2.48e-8 SMART
IG 2151 2230 3.89e-1 SMART
IG 2240 2319 1.92e0 SMART
IG 2329 2407 6.45e-7 SMART
IG 2452 2531 1.22e-7 SMART
IGc2 2637 2703 9.93e-8 SMART
low complexity region 2705 2716 N/A INTRINSIC
IG 2720 2799 2.44e0 SMART
IGc2 2815 2881 2.1e-6 SMART
IG 2898 2979 2.86e0 SMART
IGc2 2995 3061 8.38e-6 SMART
IG 3078 3157 1.2e-6 SMART
IG 3167 3248 1.42e-3 SMART
IGc2 3264 3330 3.85e-5 SMART
IGc2 3353 3419 3.13e-5 SMART
IGc2 3442 3507 3.3e-4 SMART
IGc2 3530 3595 5.84e-5 SMART
IGc2 3618 3683 1.29e-6 SMART
IG_like 3706 3771 3.16e-1 SMART
IGc2 3779 3844 1.46e-5 SMART
IGc2 3867 3932 1.56e-5 SMART
IGc2 3955 4020 1.19e-5 SMART
IGc2 4043 4108 1.93e-5 SMART
IG 4125 4203 1.85e-7 SMART
IGc2 4219 4285 5.08e-5 SMART
IGc2 4308 4374 1.11e-5 SMART
IGc2 4397 4465 6.71e-5 SMART
IG 4482 4564 2.06e-5 SMART
IG 4574 4655 5.01e-4 SMART
IG 4664 4746 1.04e-1 SMART
FN3 4749 4831 2.44e-14 SMART
IG 4858 4940 3.68e-2 SMART
IQ 5100 5122 3.65e-4 SMART
IGc2 5139 5207 8.72e-4 SMART
low complexity region 5215 5231 N/A INTRINSIC
low complexity region 5232 5248 N/A INTRINSIC
low complexity region 5251 5274 N/A INTRINSIC
IGc2 5369 5437 3.25e-12 SMART
low complexity region 5450 5466 N/A INTRINSIC
IG 5496 5580 1.55e0 SMART
IGc2 5612 5685 1.82e-6 SMART
low complexity region 5799 5829 N/A INTRINSIC
SH3 5832 5895 1.22e0 SMART
Pfam:RhoGEF 5926 6104 4.5e-21 PFAM
PH 6125 6235 2.74e-11 SMART
IGc2 6255 6323 3.73e-12 SMART
IGc2 6349 6418 1.18e-14 SMART
IGc2 6464 6531 1.7e-6 SMART
S_TKc 6562 6815 1.66e-79 SMART
Blast:STYKc 6843 6935 5e-39 BLAST
low complexity region 6939 6954 N/A INTRINSIC
low complexity region 7013 7029 N/A INTRINSIC
low complexity region 7146 7161 N/A INTRINSIC
low complexity region 7199 7219 N/A INTRINSIC
low complexity region 7499 7514 N/A INTRINSIC
IGc2 7538 7606 6.3e-10 SMART
FN3 7620 7698 9.33e-2 SMART
STYKc 7736 7988 8.55e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000052872
AA Change: Y3237H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049737
Gene: ENSMUSG00000061462
AA Change: Y3237H

DomainStartEndE-ValueType
IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 809 875 4.49e-6 SMART
IGc2 901 967 2.54e-5 SMART
IGc2 993 1059 2.54e-5 SMART
IGc2 1085 1151 4.49e-6 SMART
IGc2 1177 1243 7.82e-6 SMART
IGc2 1269 1335 5.16e-6 SMART
IGc2 1361 1427 1.93e-5 SMART
IGc2 1453 1519 1.93e-5 SMART
IGc2 1545 1611 1.93e-5 SMART
IGc2 1637 1703 1.93e-5 SMART
IGc2 1729 1795 1.93e-5 SMART
IGc2 1821 1887 1.93e-5 SMART
IGc2 1913 1979 7.94e-7 SMART
IGc2 2005 2071 6.35e-6 SMART
IG 2091 2171 5.37e-4 SMART
IG 2181 2260 9.93e-8 SMART
IG 2271 2350 2.48e-8 SMART
IG 2360 2439 3.89e-1 SMART
IG 2449 2528 1.92e0 SMART
IG 2538 2616 6.45e-7 SMART
IG 2661 2740 1.22e-7 SMART
IGc2 2846 2912 9.93e-8 SMART
low complexity region 2914 2925 N/A INTRINSIC
IG 2929 3008 2.44e0 SMART
IGc2 3024 3090 2.1e-6 SMART
IG 3107 3188 2.86e0 SMART
IGc2 3204 3270 8.38e-6 SMART
IG 3287 3366 1.2e-6 SMART
IG 3376 3457 1.42e-3 SMART
IGc2 3473 3539 3.85e-5 SMART
IGc2 3562 3628 3.13e-5 SMART
IGc2 3651 3716 3.3e-4 SMART
IGc2 3739 3804 5.84e-5 SMART
IGc2 3827 3892 1.29e-6 SMART
IG_like 3915 3980 3.16e-1 SMART
IGc2 3988 4053 1.46e-5 SMART
IGc2 4076 4141 1.25e-4 SMART
IGc2 4164 4229 1.56e-5 SMART
IGc2 4252 4317 1.19e-5 SMART
IGc2 4340 4405 1.93e-5 SMART
IGc2 4428 4493 3.91e-6 SMART
IG 4510 4588 1.85e-7 SMART
IG 4598 4676 1.03e-5 SMART
IGc2 4692 4757 5.08e-5 SMART
IGc2 4780 4846 5.08e-5 SMART
IGc2 4869 4935 1.11e-5 SMART
IGc2 4958 5026 6.71e-5 SMART
IG 5043 5125 2.06e-5 SMART
IG 5135 5216 5.01e-4 SMART
IG 5225 5307 1.04e-1 SMART
IG 5317 5399 9.12e-7 SMART
FN3 5402 5484 2.44e-14 SMART
IG 5511 5593 3.68e-2 SMART
IQ 5753 5775 3.65e-4 SMART
IGc2 5792 5860 8.72e-4 SMART
low complexity region 5868 5884 N/A INTRINSIC
low complexity region 5885 5901 N/A INTRINSIC
low complexity region 5904 5927 N/A INTRINSIC
IGc2 6022 6090 3.25e-12 SMART
low complexity region 6103 6119 N/A INTRINSIC
IG 6149 6233 1.55e0 SMART
IGc2 6265 6338 1.82e-6 SMART
low complexity region 6452 6482 N/A INTRINSIC
SH3 6485 6548 1.22e0 SMART
Pfam:RhoGEF 6579 6757 2.1e-21 PFAM
PH 6778 6888 2.74e-11 SMART
IGc2 6908 6976 3.73e-12 SMART
IGc2 7002 7071 1.18e-14 SMART
low complexity region 7112 7126 N/A INTRINSIC
low complexity region 7127 7154 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133040
AA Change: Y726H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122181
Gene: ENSMUSG00000061462
AA Change: Y726H

DomainStartEndE-ValueType
SCOP:d1wiu__ 1 51 2e-4 SMART
IG 61 140 1.44e-4 SMART
IG 150 229 1.22e-7 SMART
SCOP:d1wiu__ 234 318 6e-5 SMART
IGc2 335 401 9.93e-8 SMART
low complexity region 403 414 N/A INTRINSIC
IG 418 497 2.44e0 SMART
IGc2 513 579 2.1e-6 SMART
IG 596 677 2.86e0 SMART
IGc2 693 759 8.38e-6 SMART
IG 776 855 1.2e-6 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: The obscurin gene spans more than 150 kb, contains over 80 exons and encodes a protein of approximately 800 kDa. The encoded protein contains 68 Ig domains, 2 fibronectin domains, 1 calcium/calmodulin-binding domain, 1 RhoGEF domain with an associated PH domain, and 2 serine-threonine kinase domains. This protein is one of three giant sacromeric signaling proteins that includes titin and nebulin. It may have a role in the organization of myofibrils during assembly and also may mediate interactions between the sarcoplasmic reticulum and myofibrils. Alternatively spliced transcript variants encoding different isoforms have been described although the full-length nature is not known for all splicing variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit centrally localized nuclei in muscle fibers and mild myopathy in aged mice. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 205 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,919,278 I369T possibly damaging Het
Aass T C 6: 23,121,019 D82G probably damaging Het
Abi3bp G A 16: 56,668,279 V1258I possibly damaging Het
Acad11 T A 9: 104,063,882 V41E probably benign Het
Aff1 T G 5: 103,833,512 L514V probably damaging Het
Ankdd1b G T 13: 96,460,903 T7K probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Bag3 A T 7: 128,523,859 M1L possibly damaging Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Carmil1 T C 13: 24,041,689 T635A probably damaging Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cep63 T A 9: 102,618,867 I114F possibly damaging Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Cnr1 A G 4: 33,943,851 T80A possibly damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Col12a1 A C 9: 79,628,378 V2612G possibly damaging Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Cyp2c29 A T 19: 39,324,945 H295L possibly damaging Het
Cyp2c68 A T 19: 39,699,275 M426K possibly damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dsg2 G A 18: 20,591,880 V448I probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Eogt T C 6: 97,113,864 D438G probably damaging Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Etnppl A G 3: 130,620,749 T98A probably damaging Het
Eya2 G T 2: 165,687,663 G109W probably damaging Het
Fam131b T G 6: 42,318,580 Q221P possibly damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Gabarap C T 11: 69,991,689 probably benign Het
Gatad2a G T 8: 69,909,936 H600N probably damaging Het
Gba2 A G 4: 43,578,242 C36R probably benign Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Gm10961 T C 3: 107,632,994 probably benign Het
Gm4847 T C 1: 166,638,339 D227G possibly damaging Het
Gpr37l1 C A 1: 135,161,530 E266* probably null Het
Gucy1a2 A T 9: 3,634,957 N334Y probably benign Het
H2-D1 A G 17: 35,263,405 T34A probably damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcna5 A T 6: 126,533,860 I435N probably damaging Het
Kcnj5 T C 9: 32,322,192 I276V probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Klhl20 A G 1: 161,102,990 V314A possibly damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lin7b A T 7: 45,369,927 H72Q probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Map3k9 A T 12: 81,722,226 V1016E probably damaging Het
Mcam T C 9: 44,134,706 L6P probably damaging Het
Mgam A G 6: 40,664,860 H549R possibly damaging Het
Mrc1 T C 2: 14,327,844 V1285A probably benign Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Myh7b A G 2: 155,625,672 D739G possibly damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Nfkbib A T 7: 28,762,055 Y86N probably damaging Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrip1 G T 16: 76,292,890 T593K probably benign Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfml2b G A 1: 170,681,789 G569S probably damaging Het
Olfr1012 T A 2: 85,760,242 I45F possibly damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1307 T C 2: 111,945,288 H56R probably benign Het
Olfr1417 T A 19: 11,828,081 Q315L probably benign Het
Olfr371 A C 8: 85,230,848 M118L probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr924 T A 9: 38,848,972 I286K probably damaging Het
Olfr951 T C 9: 39,394,222 Y144H probably benign Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pard6g T A 18: 80,079,825 F25I probably damaging Het
Parp6 C A 9: 59,633,538 C291* probably null Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Polr2i T C 7: 30,233,068 C67R probably damaging Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptgfrn T C 3: 101,056,442 N618S possibly damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Rad17 C T 13: 100,622,806 R571Q probably damaging Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A C 1: 133,356,457 K187Q probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rims1 C T 1: 22,346,529 probably null Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sele T G 1: 164,054,623 V559G probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Setd1a T A 7: 127,785,124 Y382* probably null Het
Sipa1l2 A T 8: 125,480,141 probably null Het
Slc25a41 T C 17: 57,039,921 E10G probably benign Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Susd4 A G 1: 182,853,978 E128G probably damaging Het
Synpo2l G A 14: 20,665,819 P233S probably damaging Het
Tbc1d17 A C 7: 44,845,131 S227A probably damaging Het
Tfg G T 16: 56,712,789 N2K probably damaging Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tmem143 G A 7: 45,907,002 D144N possibly damaging Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Trim47 A G 11: 116,106,038 L630P probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttk A G 9: 83,868,592 N691S possibly damaging Het
Ttn T G 2: 76,716,992 T32237P probably damaging Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Uggt1 T C 1: 36,221,261 T158A probably benign Het
Usp9y A T Y: 1,367,093 V998D probably benign Het
Vwa5b2 C T 16: 20,600,925 P644S probably damaging Het
Wars A C 12: 108,875,741 F160C probably damaging Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfp541 A G 7: 16,077,973 T184A probably damaging Het
Zfp804b T C 5: 6,771,938 D375G probably damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Obscn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Obscn APN 11 59002057 missense probably benign 0.01
IGL00417:Obscn APN 11 59006788 missense unknown
IGL01018:Obscn APN 11 59128069 missense probably damaging 0.99
IGL01083:Obscn APN 11 59036093 missense probably damaging 0.99
IGL01109:Obscn APN 11 59133762 missense probably damaging 1.00
IGL01139:Obscn APN 11 59078352 missense probably damaging 1.00
IGL01361:Obscn APN 11 59028889 missense probably damaging 0.99
IGL01370:Obscn APN 11 58995563 critical splice acceptor site probably null
IGL01409:Obscn APN 11 59031058 missense probably damaging 1.00
IGL01432:Obscn APN 11 59033757 missense probably benign 0.27
IGL01527:Obscn APN 11 59064417 missense possibly damaging 0.83
IGL01543:Obscn APN 11 59042117 missense probably benign 0.01
IGL01578:Obscn APN 11 58999680 missense unknown
IGL01603:Obscn APN 11 59037805 missense probably damaging 1.00
IGL01750:Obscn APN 11 59031639 missense probably damaging 1.00
IGL01765:Obscn APN 11 59115784 missense possibly damaging 0.58
IGL01805:Obscn APN 11 59132596 missense probably damaging 0.99
IGL01816:Obscn APN 11 58995779 splice site probably benign
IGL01885:Obscn APN 11 59074968 missense possibly damaging 0.60
IGL01911:Obscn APN 11 59008595 nonsense probably null
IGL01963:Obscn APN 11 59020541 missense probably benign 0.16
IGL02012:Obscn APN 11 59076507 missense probably benign 0.03
IGL02096:Obscn APN 11 59080704 missense probably damaging 0.98
IGL02125:Obscn APN 11 59093326 missense possibly damaging 0.95
IGL02125:Obscn APN 11 59022362 missense probably damaging 1.00
IGL02203:Obscn APN 11 59082308 missense probably damaging 1.00
IGL02232:Obscn APN 11 59038978 missense probably damaging 0.97
IGL02262:Obscn APN 11 59028533 missense possibly damaging 0.88
IGL02304:Obscn APN 11 59076622 missense probably damaging 1.00
IGL02306:Obscn APN 11 58999671 missense unknown
IGL02323:Obscn APN 11 59008522 missense possibly damaging 0.51
IGL02341:Obscn APN 11 59135825 missense probably benign 0.09
IGL02342:Obscn APN 11 59001088 missense probably benign 0.00
IGL02352:Obscn APN 11 59001027 missense probably benign 0.10
IGL02397:Obscn APN 11 59076899 missense possibly damaging 0.67
IGL02405:Obscn APN 11 59132602 missense probably damaging 0.96
IGL02427:Obscn APN 11 59067162 missense probably damaging 1.00
IGL02479:Obscn APN 11 59056227 splice site probably benign
IGL02512:Obscn APN 11 59028517 missense probably damaging 1.00
IGL02566:Obscn APN 11 59068147 missense probably damaging 1.00
IGL02613:Obscn APN 11 59002132 missense probably benign 0.03
IGL02634:Obscn APN 11 59054785 missense probably damaging 1.00
IGL02680:Obscn APN 11 59000020 missense unknown
IGL02715:Obscn APN 11 59080311 missense probably benign 0.25
IGL02718:Obscn APN 11 59077858 missense probably damaging 1.00
IGL02723:Obscn APN 11 59124620 missense probably benign 0.17
IGL02735:Obscn APN 11 59093349 missense probably damaging 1.00
IGL02951:Obscn APN 11 58994513 splice site probably benign
IGL03004:Obscn APN 11 59028587 missense probably damaging 1.00
IGL03078:Obscn APN 11 59078798 splice site probably null
IGL03114:Obscn APN 11 59000539 missense unknown
IGL03125:Obscn APN 11 59061648 missense probably damaging 1.00
IGL03150:Obscn APN 11 59051723 missense probably damaging 1.00
IGL03156:Obscn APN 11 59054896 missense probably damaging 1.00
IGL03169:Obscn APN 11 59073296 missense probably damaging 1.00
IGL03297:Obscn APN 11 59060886 missense possibly damaging 0.83
IGL03326:Obscn APN 11 59032902 missense probably damaging 1.00
IGL03345:Obscn APN 11 58995482 unclassified probably benign
IGL03348:Obscn APN 11 59050362 missense probably damaging 1.00
IGL03355:Obscn APN 11 59037792 missense probably damaging 1.00
IGL03377:Obscn APN 11 58999873 missense probably damaging 1.00
IGL03396:Obscn APN 11 59073578 missense probably benign 0.12
IGL03405:Obscn APN 11 59000124 missense unknown
obscurity UTSW 11 58994700 nonsense probably null
IGL02802:Obscn UTSW 11 59000484 missense unknown
N/A - 535:Obscn UTSW 11 59000308 missense possibly damaging 0.67
PIT4131001:Obscn UTSW 11 59067064 critical splice donor site probably null
R0033:Obscn UTSW 11 58994746 unclassified probably benign
R0041:Obscn UTSW 11 59043977 missense probably damaging 1.00
R0042:Obscn UTSW 11 59052585 missense probably damaging 1.00
R0064:Obscn UTSW 11 59027466 missense probably damaging 1.00
R0064:Obscn UTSW 11 59027466 missense probably damaging 1.00
R0071:Obscn UTSW 11 59064201 missense possibly damaging 0.85
R0077:Obscn UTSW 11 59051521 splice site probably benign
R0083:Obscn UTSW 11 59022374 missense probably damaging 1.00
R0089:Obscn UTSW 11 59000062 missense unknown
R0092:Obscn UTSW 11 59051247 missense possibly damaging 0.96
R0103:Obscn UTSW 11 59062696 nonsense probably null
R0103:Obscn UTSW 11 59062696 nonsense probably null
R0108:Obscn UTSW 11 59022374 missense probably damaging 1.00
R0152:Obscn UTSW 11 59052576 missense probably benign 0.06
R0268:Obscn UTSW 11 59067272 missense possibly damaging 0.78
R0271:Obscn UTSW 11 59056742 intron probably benign
R0281:Obscn UTSW 11 59038615 missense probably damaging 1.00
R0329:Obscn UTSW 11 59040441 missense probably damaging 1.00
R0329:Obscn UTSW 11 59052506 missense probably damaging 1.00
R0360:Obscn UTSW 11 59128281 missense probably benign 0.22
R0364:Obscn UTSW 11 59128281 missense probably benign 0.22
R0382:Obscn UTSW 11 59040306 missense probably damaging 1.00
R0386:Obscn UTSW 11 59136339 missense probably damaging 1.00
R0403:Obscn UTSW 11 59076540 missense probably damaging 1.00
R0413:Obscn UTSW 11 59002997 missense probably benign 0.03
R0437:Obscn UTSW 11 58995088 unclassified probably benign
R0442:Obscn UTSW 11 59002174 splice site probably benign
R0445:Obscn UTSW 11 58999335 missense unknown
R0446:Obscn UTSW 11 58995412 unclassified probably benign
R0454:Obscn UTSW 11 58999623 missense unknown
R0463:Obscn UTSW 11 59061530 missense probably benign 0.07
R0479:Obscn UTSW 11 59112707 missense probably damaging 1.00
R0480:Obscn UTSW 11 59133946 nonsense probably null
R0504:Obscn UTSW 11 59008507 critical splice donor site probably null
R0507:Obscn UTSW 11 59029341 missense probably damaging 1.00
R0513:Obscn UTSW 11 59061522 missense possibly damaging 0.81
R0541:Obscn UTSW 11 59081984 missense probably damaging 1.00
R0551:Obscn UTSW 11 59107862 nonsense probably null
R0573:Obscn UTSW 11 59036079 missense probably damaging 1.00
R0599:Obscn UTSW 11 59073696 missense probably damaging 1.00
R0637:Obscn UTSW 11 59051644 missense probably damaging 1.00
R0637:Obscn UTSW 11 59082776 missense probably damaging 0.96
R0653:Obscn UTSW 11 59007708 unclassified probably benign
R0712:Obscn UTSW 11 59049445 missense possibly damaging 0.72
R0715:Obscn UTSW 11 59050480 missense probably benign 0.23
R0729:Obscn UTSW 11 59032709 missense probably damaging 1.00
R0741:Obscn UTSW 11 59063453 frame shift probably null
R0745:Obscn UTSW 11 59082239 missense probably benign 0.14
R0751:Obscn UTSW 11 59081819 missense probably damaging 1.00
R0834:Obscn UTSW 11 59133278 missense probably benign 0.25
R0863:Obscn UTSW 11 58995415 unclassified probably benign
R0909:Obscn UTSW 11 59075064 missense probably damaging 1.00
R0965:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R0969:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R0980:Obscn UTSW 11 58998061 missense possibly damaging 0.92
R1017:Obscn UTSW 11 58998353 missense unknown
R1103:Obscn UTSW 11 59021483 missense probably damaging 1.00
R1107:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R1128:Obscn UTSW 11 59028943 missense probably null 0.71
R1164:Obscn UTSW 11 59036087 missense possibly damaging 0.65
R1192:Obscn UTSW 11 59067199 missense probably benign 0.33
R1298:Obscn UTSW 11 59054897 missense possibly damaging 0.65
R1331:Obscn UTSW 11 59086928 missense probably benign 0.09
R1333:Obscn UTSW 11 59080317 missense probably damaging 0.99
R1341:Obscn UTSW 11 59029372 splice site probably benign
R1385:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R1386:Obscn UTSW 11 59133853 missense probably damaging 1.00
R1390:Obscn UTSW 11 59093448 missense probably damaging 1.00
R1460:Obscn UTSW 11 59055966 missense probably damaging 1.00
R1495:Obscn UTSW 11 59080160 missense probably damaging 0.99
R1496:Obscn UTSW 11 59031036 missense probably benign 0.01
R1524:Obscn UTSW 11 59115855 missense probably damaging 1.00
R1526:Obscn UTSW 11 59028586 missense probably damaging 1.00
R1537:Obscn UTSW 11 59000749 missense unknown
R1554:Obscn UTSW 11 59003648 missense unknown
R1561:Obscn UTSW 11 59036073 missense probably damaging 1.00
R1589:Obscn UTSW 11 59036075 missense possibly damaging 0.89
R1615:Obscn UTSW 11 59099825 missense probably benign 0.09
R1627:Obscn UTSW 11 59112638 missense probably benign 0.14
R1634:Obscn UTSW 11 59076896 missense probably damaging 1.00
R1636:Obscn UTSW 11 59122637 missense probably damaging 1.00
R1681:Obscn UTSW 11 59103325 missense probably damaging 1.00
R1686:Obscn UTSW 11 59106287 splice site probably benign
R1713:Obscn UTSW 11 59079886 missense probably damaging 1.00
R1781:Obscn UTSW 11 59106337 missense probably damaging 1.00
R1783:Obscn UTSW 11 59073633 missense probably damaging 1.00
R1793:Obscn UTSW 11 59077780 missense probably damaging 1.00
R1796:Obscn UTSW 11 59029337 missense possibly damaging 0.94
R1801:Obscn UTSW 11 58998321 missense unknown
R1824:Obscn UTSW 11 58994832 unclassified probably benign
R1856:Obscn UTSW 11 59040296 missense probably damaging 1.00
R1866:Obscn UTSW 11 59060915 missense probably benign 0.34
R1878:Obscn UTSW 11 58995553 missense probably damaging 0.99
R1883:Obscn UTSW 11 59078203 missense probably damaging 1.00
R1926:Obscn UTSW 11 59063474 missense possibly damaging 0.69
R1967:Obscn UTSW 11 59135709 nonsense probably null
R1975:Obscn UTSW 11 59067729 missense probably damaging 1.00
R1992:Obscn UTSW 11 58995827 unclassified probably benign
R2021:Obscn UTSW 11 59067174 missense probably benign 0.40
R2066:Obscn UTSW 11 59135732 missense possibly damaging 0.59
R2074:Obscn UTSW 11 59069281 missense probably damaging 0.99
R2074:Obscn UTSW 11 59132652 missense probably damaging 1.00
R2081:Obscn UTSW 11 59034182 missense possibly damaging 0.90
R2083:Obscn UTSW 11 59073631 nonsense probably null
R2086:Obscn UTSW 11 59078256 missense probably damaging 0.99
R2095:Obscn UTSW 11 59093584 splice site probably null
R2098:Obscn UTSW 11 59069991 missense probably damaging 1.00
R2114:Obscn UTSW 11 59131658 missense probably damaging 0.99
R2138:Obscn UTSW 11 59003665 nonsense probably null
R2193:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2194:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2210:Obscn UTSW 11 59068087 missense probably damaging 1.00
R2233:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2234:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2287:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2288:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2351:Obscn UTSW 11 59112612 missense probably damaging 0.99
R2376:Obscn UTSW 11 59069124 missense probably damaging 1.00
R2384:Obscn UTSW 11 59042837 critical splice donor site probably null
R2401:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2402:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2403:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2424:Obscn UTSW 11 58994451 unclassified probably benign
R2433:Obscn UTSW 11 59039086 unclassified probably null
R2445:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2446:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2447:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2449:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2483:Obscn UTSW 11 59080146 missense probably damaging 1.00
R2484:Obscn UTSW 11 59007540 unclassified probably benign
R2496:Obscn UTSW 11 59103442 missense probably damaging 1.00
R2510:Obscn UTSW 11 59042314 splice site probably benign
R2851:Obscn UTSW 11 59030018 critical splice donor site probably null
R2878:Obscn UTSW 11 59056188 missense possibly damaging 0.94
R2879:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2885:Obscn UTSW 11 59086748 missense probably damaging 1.00
R2885:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2886:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2985:Obscn UTSW 11 59133089 missense probably damaging 1.00
R3013:Obscn UTSW 11 59060918 missense probably damaging 1.00
R3118:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3236:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3237:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3432:Obscn UTSW 11 59031177 missense probably damaging 1.00
R3694:Obscn UTSW 11 59078395 missense probably damaging 1.00
R3716:Obscn UTSW 11 59082661 missense probably damaging 1.00
R3717:Obscn UTSW 11 59082661 missense probably damaging 1.00
R3743:Obscn UTSW 11 59079085 missense probably damaging 0.99
R3760:Obscn UTSW 11 59028580 missense probably damaging 1.00
R3795:Obscn UTSW 11 59031841 missense probably damaging 1.00
R3857:Obscn UTSW 11 59080969 unclassified probably benign
R3858:Obscn UTSW 11 59080969 unclassified probably benign
R3862:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3863:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3864:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3881:Obscn UTSW 11 59056949 missense probably damaging 1.00
R3890:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3903:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3923:Obscn UTSW 11 59060928 missense possibly damaging 0.96
R3944:Obscn UTSW 11 59132547 missense probably damaging 1.00
R3947:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3948:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3955:Obscn UTSW 11 59036768 missense probably damaging 1.00
R3970:Obscn UTSW 11 59051662 missense probably damaging 1.00
R3971:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4001:Obscn UTSW 11 59134569 missense probably damaging 1.00
R4005:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4017:Obscn UTSW 11 59132622 missense probably damaging 1.00
R4028:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4029:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4041:Obscn UTSW 11 59051531 nonsense probably null
R4061:Obscn UTSW 11 59008532 missense probably damaging 1.00
R4062:Obscn UTSW 11 59082710 missense probably damaging 0.99
R4072:Obscn UTSW 11 58997183 missense unknown
R4078:Obscn UTSW 11 59038363 missense probably benign 0.41
R4079:Obscn UTSW 11 59038363 missense probably benign 0.41
R4092:Obscn UTSW 11 59056060 missense probably benign 0.12
R4106:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4108:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4403:Obscn UTSW 11 59069093 missense possibly damaging 0.95
R4477:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4478:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4480:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4489:Obscn UTSW 11 59031591 missense possibly damaging 0.74
R4531:Obscn UTSW 11 59007874 unclassified probably benign
R4551:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4552:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4553:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4558:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4570:Obscn UTSW 11 59006828 splice site probably null
R4575:Obscn UTSW 11 59122772 missense probably damaging 0.99
R4593:Obscn UTSW 11 59133249 missense probably damaging 1.00
R4604:Obscn UTSW 11 59080205 missense probably damaging 1.00
R4604:Obscn UTSW 11 59122746 missense probably damaging 0.96
R4625:Obscn UTSW 11 59067258 missense probably damaging 1.00
R4646:Obscn UTSW 11 59124570 nonsense probably null
R4651:Obscn UTSW 11 59038877 missense probably damaging 1.00
R4652:Obscn UTSW 11 59038877 missense probably damaging 1.00
R4657:Obscn UTSW 11 59042290 missense probably damaging 1.00
R4658:Obscn UTSW 11 59054288 nonsense probably null
R4662:Obscn UTSW 11 58999596 missense unknown
R4665:Obscn UTSW 11 59124752 missense probably damaging 1.00
R4718:Obscn UTSW 11 59021954 missense probably damaging 1.00
R4736:Obscn UTSW 11 59063536 missense probably damaging 1.00
R4746:Obscn UTSW 11 59079808 critical splice donor site probably null
R4754:Obscn UTSW 11 59036043 missense possibly damaging 0.81
R4758:Obscn UTSW 11 59003363 missense unknown
R4758:Obscn UTSW 11 59135917 missense probably damaging 0.98
R4766:Obscn UTSW 11 59012742 missense probably damaging 1.00
R4798:Obscn UTSW 11 59069859 missense probably damaging 0.99
R4810:Obscn UTSW 11 59031591 missense possibly damaging 0.74
R4819:Obscn UTSW 11 59038848 missense probably damaging 0.97
R4821:Obscn UTSW 11 59006826 splice site probably benign
R4821:Obscn UTSW 11 59040467 missense probably damaging 1.00
R4822:Obscn UTSW 11 59022333 missense probably benign 0.11
R4828:Obscn UTSW 11 59086670 missense possibly damaging 0.93
R4829:Obscn UTSW 11 59054246 missense probably null 0.53
R4830:Obscn UTSW 11 59067607 missense probably damaging 1.00
R4859:Obscn UTSW 11 59082023 missense possibly damaging 0.89
R4870:Obscn UTSW 11 59136206 missense probably damaging 1.00
R4909:Obscn UTSW 11 59061465 missense possibly damaging 0.52
R4955:Obscn UTSW 11 59069172 missense probably benign 0.31
R4973:Obscn UTSW 11 59132466 missense probably damaging 1.00
R4993:Obscn UTSW 11 59124761 missense possibly damaging 0.48
R5034:Obscn UTSW 11 59061676 nonsense probably null
R5054:Obscn UTSW 11 59073617 missense probably damaging 1.00
R5077:Obscn UTSW 11 59044057 missense probably damaging 0.98
R5126:Obscn UTSW 11 59077063 missense probably damaging 1.00
R5135:Obscn UTSW 11 59129653 missense probably damaging 1.00
R5161:Obscn UTSW 11 59028604 missense probably damaging 1.00
R5161:Obscn UTSW 11 59064310 missense possibly damaging 0.60
R5195:Obscn UTSW 11 59060850 missense possibly damaging 0.78
R5222:Obscn UTSW 11 59044145 missense possibly damaging 0.80
R5260:Obscn UTSW 11 59003369 missense probably damaging 1.00
R5301:Obscn UTSW 11 59135408 missense probably damaging 1.00
R5305:Obscn UTSW 11 59012715 missense possibly damaging 0.83
R5323:Obscn UTSW 11 58996877 missense probably benign
R5333:Obscn UTSW 11 59062692 missense probably damaging 1.00
R5366:Obscn UTSW 11 59080260 missense probably damaging 1.00
R5368:Obscn UTSW 11 59069026 critical splice donor site probably null
R5408:Obscn UTSW 11 59051611 missense probably damaging 1.00
R5439:Obscn UTSW 11 59000128 nonsense probably null
R5536:Obscn UTSW 11 59107871 missense probably damaging 1.00
R5561:Obscn UTSW 11 59036093 missense probably damaging 0.99
R5573:Obscn UTSW 11 59034705 missense possibly damaging 0.94
R5582:Obscn UTSW 11 59099976 splice site probably null
R5586:Obscn UTSW 11 59001468 nonsense probably null
R5607:Obscn UTSW 11 59122848 missense probably benign 0.22
R5700:Obscn UTSW 11 59133194 missense probably benign 0.37
R5706:Obscn UTSW 11 59076256 missense probably damaging 1.00
R5718:Obscn UTSW 11 59036808 missense probably damaging 1.00
R5771:Obscn UTSW 11 59000707 missense unknown
R5772:Obscn UTSW 11 59056144 missense probably damaging 0.99
R5786:Obscn UTSW 11 59032691 missense probably damaging 1.00
R5807:Obscn UTSW 11 59079650 missense probably damaging 1.00
R5815:Obscn UTSW 11 59082189 splice site probably null
R5835:Obscn UTSW 11 59002081 missense probably benign 0.03
R5835:Obscn UTSW 11 59042127 missense probably damaging 1.00
R5846:Obscn UTSW 11 59038609 missense probably damaging 1.00
R5851:Obscn UTSW 11 58994700 nonsense probably null
R5933:Obscn UTSW 11 58998505 missense unknown
R5935:Obscn UTSW 11 59006813 missense unknown
R5974:Obscn UTSW 11 59076547 missense probably damaging 1.00
R5975:Obscn UTSW 11 59122619 critical splice donor site probably null
R6014:Obscn UTSW 11 59038864 missense probably damaging 1.00
R6026:Obscn UTSW 11 59067090 missense probably damaging 0.98
R6082:Obscn UTSW 11 58999567 missense unknown
R6124:Obscn UTSW 11 59079044 missense probably benign 0.45
R6130:Obscn UTSW 11 59077945 missense possibly damaging 0.90
R6160:Obscn UTSW 11 59051785 missense probably damaging 1.00
R6169:Obscn UTSW 11 59000499 missense unknown
R6177:Obscn UTSW 11 59032664 missense probably damaging 1.00
R6189:Obscn UTSW 11 59069934 missense probably benign 0.00
R6192:Obscn UTSW 11 58998038 missense unknown
R6195:Obscn UTSW 11 58997207 missense probably damaging 0.98
R6208:Obscn UTSW 11 59067648 missense possibly damaging 0.81
R6232:Obscn UTSW 11 59052511 nonsense probably null
R6233:Obscn UTSW 11 58997207 missense probably damaging 0.98
R6273:Obscn UTSW 11 59076993 missense possibly damaging 0.95
R6280:Obscn UTSW 11 59063683 missense possibly damaging 0.82
R6317:Obscn UTSW 11 59069895 missense probably damaging 1.00
R6345:Obscn UTSW 11 59053696 missense probably damaging 0.99
R6378:Obscn UTSW 11 59073746 missense probably damaging 1.00
R6382:Obscn UTSW 11 58999413 missense unknown
R6382:Obscn UTSW 11 59042208 missense probably damaging 0.99
R6415:Obscn UTSW 11 59035130 missense probably damaging 0.99
R6433:Obscn UTSW 11 59051558 missense probably benign 0.14
R6457:Obscn UTSW 11 59080771 missense probably damaging 0.99
R6508:Obscn UTSW 11 59054147 splice site probably null
R6611:Obscn UTSW 11 59064230 synonymous probably null
R6614:Obscn UTSW 11 59012801 missense probably benign 0.01
R6645:Obscn UTSW 11 59085262 missense probably damaging 0.97
R6646:Obscn UTSW 11 59082718 missense possibly damaging 0.72
R6659:Obscn UTSW 11 59039009 missense probably damaging 1.00
R6723:Obscn UTSW 11 59054998 missense probably damaging 0.99
R6733:Obscn UTSW 11 59028595 missense probably damaging 0.99
R6755:Obscn UTSW 11 59103326 missense probably damaging 1.00
R6770:Obscn UTSW 11 59044036 missense possibly damaging 0.88
R6820:Obscn UTSW 11 59051193 missense probably damaging 1.00
R6823:Obscn UTSW 11 59067943 critical splice donor site probably null
R6850:Obscn UTSW 11 59002129 missense possibly damaging 0.92
R6850:Obscn UTSW 11 59068124 missense possibly damaging 0.93
R6862:Obscn UTSW 11 58995453 unclassified probably benign
R6884:Obscn UTSW 11 59078302 missense probably damaging 1.00
R6894:Obscn UTSW 11 59132682 missense probably benign 0.43
R6906:Obscn UTSW 11 59032918 missense possibly damaging 0.85
R6944:Obscn UTSW 11 59038930 missense probably damaging 1.00
R6948:Obscn UTSW 11 59106316 missense probably damaging 1.00
R6959:Obscn UTSW 11 59037585 missense probably damaging 1.00
X0010:Obscn UTSW 11 58995553 unclassified probably benign
X0012:Obscn UTSW 11 59006776 missense unknown
X0021:Obscn UTSW 11 59077906 missense probably damaging 0.96
X0058:Obscn UTSW 11 59035968 missense probably damaging 1.00
X0061:Obscn UTSW 11 59077830 missense probably damaging 1.00
X0063:Obscn UTSW 11 59000056 missense unknown
X0067:Obscn UTSW 11 59131801 missense probably benign 0.19
Y4336:Obscn UTSW 11 59131646 missense possibly damaging 0.90
Y4337:Obscn UTSW 11 59131646 missense possibly damaging 0.90
Y4338:Obscn UTSW 11 59131646 missense possibly damaging 0.90
Y5407:Obscn UTSW 11 59021943 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATCTCCTACGACCACGCAGGTTC -3'
(R):5'- GACTATGTGGCTAACGGCTGGTTC -3'

Sequencing Primer
(F):5'- ACCACGCAGGTTCTGTCC -3'
(R):5'- AACGGCTGGTTCTGTGGC -3'
Posted On2014-05-23