Incidental Mutation 'R1732:Acacb'
ID199376
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Nameacetyl-Coenzyme A carboxylase beta
SynonymsAcc2, Accb
MMRRC Submission 039764-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1732 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114146535-114250761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114190087 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 303 (M303L)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582] [ENSMUST00000146841]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031583
AA Change: M303L

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: M303L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102582
AA Change: M303L

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: M303L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146841
AA Change: M111L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115432
Gene: ENSMUSG00000042010
AA Change: M111L

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 57 146 6.4e-19 PFAM
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C A 12: 71,219,221 Q1445K probably benign Het
Actl9 T C 17: 33,433,122 V52A probably damaging Het
Adam7 T C 14: 68,498,450 T781A probably benign Het
Agpat4 T C 17: 12,216,728 V293A probably benign Het
Ank1 T A 8: 23,111,463 probably benign Het
Atp1a1 C A 3: 101,584,799 G587V probably damaging Het
Avpr1b T C 1: 131,600,254 F172L probably damaging Het
Bmp1 A T 14: 70,486,265 D710E possibly damaging Het
Cep126 A T 9: 8,099,761 I924N probably benign Het
Chek2 G T 5: 110,872,102 A517S probably benign Het
Cmbl A T 15: 31,588,232 E165D probably damaging Het
Cntnap3 A T 13: 64,740,812 probably null Het
Col1a1 A T 11: 94,944,415 probably benign Het
Ctbp2 T C 7: 132,998,924 M624V possibly damaging Het
Cwc15 A G 9: 14,510,247 D203G probably benign Het
Cyld C T 8: 88,731,667 probably benign Het
Cyp3a57 A T 5: 145,365,645 I84F probably damaging Het
Dennd3 T A 15: 73,537,418 probably benign Het
Desi2 A C 1: 178,256,651 probably benign Het
Dmxl1 T A 18: 49,893,444 L1873* probably null Het
Dmxl1 T A 18: 49,902,988 H2359Q probably benign Het
Ephb4 A G 5: 137,372,178 N880S possibly damaging Het
F10 T C 8: 13,050,764 L214P probably damaging Het
F5 G A 1: 164,174,150 V141M probably damaging Het
Fam135a A T 1: 24,026,653 S1022T possibly damaging Het
Fam13b A T 18: 34,487,134 N232K probably benign Het
Fyco1 T C 9: 123,819,092 E1259G probably benign Het
Gak A T 5: 108,576,582 D1087E probably benign Het
Gm7138 A T 10: 77,776,848 probably benign Het
Gm8674 T A 13: 49,901,926 noncoding transcript Het
Gpr25 A G 1: 136,260,128 V249A probably benign Het
Hcn3 T C 3: 89,148,119 H607R probably damaging Het
Hdac4 T A 1: 91,947,535 T905S probably benign Het
Itgad T C 7: 128,205,107 S86P probably benign Het
Itgb4 G T 11: 115,988,918 R632L probably damaging Het
Kcnb2 A T 1: 15,709,755 T284S probably benign Het
Klhl22 T A 16: 17,777,024 M339K probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mybpc2 C A 7: 44,513,675 V484L probably benign Het
Noa1 A T 5: 77,306,374 V473E probably benign Het
Nwd1 C G 8: 72,666,835 S242C possibly damaging Het
Olfr545 C A 7: 102,494,040 C245F probably damaging Het
Olfr868 A G 9: 20,101,500 H247R probably damaging Het
Otof A T 5: 30,386,471 W535R probably damaging Het
Peg3 T C 7: 6,709,085 E1046G possibly damaging Het
Phldb2 T C 16: 45,757,166 E1132G probably damaging Het
Phtf2 A T 5: 20,789,627 probably null Het
Plce1 G T 19: 38,716,838 A896S possibly damaging Het
Prim1 T C 10: 128,015,324 Y26H probably damaging Het
Prr12 T A 7: 45,048,356 T712S unknown Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Ptpdc1 T C 13: 48,586,545 E409G probably benign Het
Rabep1 A G 11: 70,904,641 N274S probably damaging Het
Rbm14 A G 19: 4,803,467 S296P probably benign Het
Rec114 A G 9: 58,653,106 S206P probably damaging Het
Rps6ka1 A T 4: 133,860,070 Y531N probably damaging Het
Slc28a2 T C 2: 122,449,758 probably benign Het
Slc34a1 A G 13: 55,413,420 H566R probably benign Het
Slc9c1 A G 16: 45,552,928 T290A probably benign Het
Smarcc1 T A 9: 110,185,820 probably benign Het
Srp54b T A 12: 55,252,759 probably null Het
Stambpl1 C G 19: 34,226,721 N70K probably damaging Het
Synj1 T C 16: 90,964,230 K710E probably damaging Het
Tenm3 T A 8: 48,310,634 D795V probably damaging Het
Tgm2 T C 2: 158,134,357 Y149C probably damaging Het
Tmem151a C A 19: 5,082,867 A104S probably damaging Het
Top1mt A G 15: 75,666,251 probably null Het
Tpgs1 T A 10: 79,675,594 L190Q possibly damaging Het
Triobp T A 15: 78,967,228 H527Q possibly damaging Het
Tspan2 A G 3: 102,768,877 I197V probably damaging Het
Ube3b A G 5: 114,387,445 I76V probably benign Het
Vmn1r32 A T 6: 66,553,301 S164T probably benign Het
Zfp607a G T 7: 27,878,459 C318F probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTAATAATACCCATCCCCGCCTTT -3'
(R):5'- TGCATTGCACCCAGCACACT -3'

Sequencing Primer
(F):5'- TTATCCTAAAGCATAGCCATTGCC -3'
(R):5'- ACTGCTGTGTCCCATCAGG -3'
Posted On2014-05-23