Incidental Mutation 'R1733:Olfr1307'
ID199451
Institutional Source Beutler Lab
Gene Symbol Olfr1307
Ensembl Gene ENSMUSG00000094747
Gene Nameolfactory receptor 1307
SynonymsMOR245-19P, GA_x6K02T2Q125-72988111-72987173
MMRRC Submission 039765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1733 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111930116-111949440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111945280 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 59 (M59L)
Ref Sequence ENSEMBL: ENSMUSP00000097201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099604] [ENSMUST00000099606]
Predicted Effect probably benign
Transcript: ENSMUST00000099604
AA Change: M59L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097199
Gene: ENSMUSG00000094747
AA Change: M59L

DomainStartEndE-ValueType
Pfam:7tm_4 38 311 1.5e-36 PFAM
Pfam:7tm_1 49 295 6.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099606
AA Change: M59L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097201
Gene: ENSMUSG00000094747
AA Change: M59L

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-42 PFAM
Pfam:7tm_1 41 287 6.7e-23 PFAM
Meta Mutation Damage Score 0.1484 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T G 18: 59,031,929 C1034W probably damaging Het
Agbl2 G T 2: 90,810,745 K737N probably damaging Het
Aqp9 T A 9: 71,112,342 I279F possibly damaging Het
Aspm T A 1: 139,457,117 N166K probably benign Het
Atp13a3 A T 16: 30,357,266 I186N probably benign Het
Btaf1 A T 19: 36,994,962 I1366L probably benign Het
Camk4 A C 18: 33,078,021 K60Q possibly damaging Het
Card11 G T 5: 140,906,633 Q226K possibly damaging Het
Ccdc187 T C 2: 26,293,658 D110G possibly damaging Het
Col5a2 C T 1: 45,407,032 R462Q possibly damaging Het
Cp A T 3: 19,968,219 probably benign Het
Cpz A T 5: 35,517,758 V38E probably damaging Het
Cxcr6 G A 9: 123,810,116 V68I probably damaging Het
Cyp2a22 C A 7: 26,934,762 E322D possibly damaging Het
D130052B06Rik C T 11: 33,623,784 T127I probably benign Het
Daam2 T A 17: 49,490,203 M185L possibly damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Dnttip2 T A 3: 122,276,748 S537R probably benign Het
Dock9 G T 14: 121,626,880 H572Q probably benign Het
Dpp4 T A 2: 62,372,869 probably null Het
Enc1 T G 13: 97,245,042 I20S possibly damaging Het
Ephb6 T A 6: 41,619,720 H900Q probably benign Het
Ercc3 T C 18: 32,267,165 V690A possibly damaging Het
Fam90a1a C T 8: 21,963,369 Q247* probably null Het
Fkbp10 G A 11: 100,423,931 R423H probably benign Het
Fus A G 7: 127,981,545 M265V probably benign Het
Gas2l3 T A 10: 89,414,265 K330N probably damaging Het
Gpam T G 19: 55,081,469 L410F probably damaging Het
Gpr37l1 A T 1: 135,161,535 V264E possibly damaging Het
Grk6 A T 13: 55,453,166 probably benign Het
Gsto1 G T 19: 47,855,235 V19F probably damaging Het
H1fnt G T 15: 98,256,135 Q378K unknown Het
Hgfac G A 5: 35,043,674 C194Y probably damaging Het
Hivep1 A G 13: 42,157,931 N1216D probably damaging Het
Hrg C T 16: 22,951,247 A42V probably damaging Het
Irx4 A G 13: 73,266,705 D136G probably benign Het
Kcnn3 G T 3: 89,652,090 V556L probably benign Het
Klk8 T C 7: 43,802,121 Y179H possibly damaging Het
Klrb1f T A 6: 129,054,359 L173* probably null Het
Kremen2 A T 17: 23,743,399 probably null Het
Krt25 A T 11: 99,316,552 Y400* probably null Het
Lingo4 A T 3: 94,403,178 R474S probably benign Het
Lnpep T C 17: 17,553,313 K599E probably benign Het
Mapk8ip3 A T 17: 24,936,850 M2K possibly damaging Het
Mat2b A T 11: 40,680,077 S307T probably benign Het
Mcph1 C A 8: 18,631,963 A372D probably benign Het
Mfsd6 T A 1: 52,709,365 I114F probably damaging Het
Mlkl A G 8: 111,322,748 S248P probably damaging Het
Mmrn1 A T 6: 60,977,101 T789S probably benign Het
Mphosph8 A G 14: 56,693,459 Y735C probably damaging Het
Mrc1 T A 2: 14,257,099 Y300N probably damaging Het
Mrps11 A G 7: 78,792,712 H180R probably damaging Het
Msh4 T C 3: 153,867,767 D556G probably damaging Het
Myh10 C A 11: 68,802,296 D1472E probably benign Het
Myo16 T C 8: 10,442,283 S742P probably damaging Het
Nlrp5-ps C T 7: 14,583,053 noncoding transcript Het
Nrp1 C T 8: 128,468,493 P477S probably benign Het
Olfr1278 T C 2: 111,292,865 V199A probably damaging Het
Olfr64 T C 7: 103,892,911 S275G probably benign Het
Olfr936 G T 9: 39,047,382 H57N unknown Het
Oplah G T 15: 76,302,483 C665* probably null Het
Otogl T C 10: 107,783,712 T1696A possibly damaging Het
Pdzrn4 A G 15: 92,401,974 I242V probably benign Het
Phgdh G A 3: 98,328,135 T141I probably benign Het
Pigv T C 4: 133,664,926 Y311C probably damaging Het
Pik3c2a T G 7: 116,418,520 M1L possibly damaging Het
Pitpnm1 A T 19: 4,109,960 K760* probably null Het
Pnrc1 G A 4: 33,246,438 H174Y probably damaging Het
Ptgis A G 2: 167,191,968 probably benign Het
Ptpn4 T C 1: 119,716,043 probably null Het
Rin3 T A 12: 102,369,330 L420* probably null Het
Sacs T G 14: 61,205,454 F1650V probably damaging Het
Sbno2 T A 10: 80,058,508 N1081Y possibly damaging Het
Sema5b C T 16: 35,646,367 P213L probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint6 T A 4: 113,177,037 probably benign Het
Slc4a2 A G 5: 24,429,567 E68G probably damaging Het
Srcin1 C T 11: 97,533,501 V634I probably benign Het
Srsf10 T A 4: 135,863,165 F134I possibly damaging Het
Stab1 C A 14: 31,145,303 G1700V probably damaging Het
Sun1 T G 5: 139,230,789 C290W possibly damaging Het
Svs6 T A 2: 164,317,657 probably benign Het
Tmem8b G A 4: 43,690,228 probably null Het
Usp49 A G 17: 47,672,313 D81G probably damaging Het
Vmn1r215 T A 13: 23,076,678 V296D probably benign Het
Vmn1r6 T A 6: 57,002,622 S90T probably damaging Het
Wbp2 A G 11: 116,083,883 F42L probably benign Het
Wdr20rt C T 12: 65,227,281 T333I possibly damaging Het
Zfp341 C T 2: 154,641,378 A552V probably benign Het
Zfp607b A T 7: 27,692,524 H8L possibly damaging Het
Zfp758 G T 17: 22,375,849 D439Y probably damaging Het
Zfp946 T C 17: 22,453,557 Y46H probably damaging Het
Zic2 G A 14: 122,478,947 E432K probably damaging Het
Other mutations in Olfr1307
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Olfr1307 APN 2 111944518 makesense probably null
IGL01947:Olfr1307 APN 2 111944994 missense probably benign 0.26
IGL02373:Olfr1307 APN 2 111944833 missense probably benign 0.01
IGL02682:Olfr1307 APN 2 111944940 missense probably damaging 1.00
R0714:Olfr1307 UTSW 2 111944553 missense probably benign 0.01
R1670:Olfr1307 UTSW 2 111944919 missense probably damaging 1.00
R1730:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R1773:Olfr1307 UTSW 2 111944859 missense possibly damaging 0.55
R1783:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R2180:Olfr1307 UTSW 2 111945003 missense probably benign 0.39
R2197:Olfr1307 UTSW 2 111945313 missense possibly damaging 0.64
R2207:Olfr1307 UTSW 2 111944925 missense probably damaging 1.00
R2377:Olfr1307 UTSW 2 111944643 missense probably damaging 1.00
R4425:Olfr1307 UTSW 2 111945189 missense probably benign 0.00
R4595:Olfr1307 UTSW 2 111944652 missense possibly damaging 0.86
R4859:Olfr1307 UTSW 2 111944811 missense probably damaging 0.98
R4910:Olfr1307 UTSW 2 111945078 missense possibly damaging 0.69
R5167:Olfr1307 UTSW 2 111945102 missense probably damaging 1.00
R5537:Olfr1307 UTSW 2 111945048 missense probably damaging 1.00
R6328:Olfr1307 UTSW 2 111945394 missense probably null 0.41
R6877:Olfr1307 UTSW 2 111944839 missense probably benign 0.16
R7011:Olfr1307 UTSW 2 111944686 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCCTCGGGCTCATAATGGTCAG -3'
(R):5'- AGAGTGAATCAGTCTGTGGTGTCAGAG -3'

Sequencing Primer
(F):5'- GGGCTCATAATGGTCAGGTAATG -3'
(R):5'- GTGTCAGAGTTTGTGTTCCTG -3'
Posted On2014-05-23