Incidental Mutation 'R1733:Cp'
Institutional Source Beutler Lab
Gene Symbol Cp
Ensembl Gene ENSMUSG00000003617
Gene Nameceruloplasmin
MMRRC Submission 039765-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1733 (G1)
Quality Score225
Status Validated
Chromosomal Location19957054-20009145 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 19968219 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000091309] [ENSMUST00000108325] [ENSMUST00000108328] [ENSMUST00000108329]
Predicted Effect probably benign
Transcript: ENSMUST00000003714
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617

Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091309
SMART Domains Protein: ENSMUSP00000088857
Gene: ENSMUSG00000003617

Pfam:Cu-oxidase_3 90 203 7.7e-8 PFAM
Pfam:Cu-oxidase 220 357 1.1e-11 PFAM
Pfam:Cu-oxidase_2 280 357 2e-7 PFAM
Pfam:Cu-oxidase_3 444 557 4.6e-7 PFAM
Blast:FA58C 599 674 2e-6 BLAST
Pfam:Cu-oxidase_3 790 898 3.4e-9 PFAM
Pfam:Cu-oxidase_2 928 1055 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108325
SMART Domains Protein: ENSMUSP00000103961
Gene: ENSMUSG00000003617

Pfam:Cu-oxidase_3 90 203 4.9e-8 PFAM
Pfam:Cu-oxidase 220 357 9.3e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 2e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.2e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108328
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617

Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108329
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617

Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174803
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: The protein encoded by this gene is a copper-containing glycoprotein found soluble in the serum and GPI-anchored in other tissues. It oxidizes Fe(II) to Fe(III) and is proposed to play an important role in iron homeostasis. In humans mutations of this gene cause aceruloplasminemia, which is characterized by retinal degeneration, diabetes, anemia and neurological symptoms. In mouse deficiency of this gene in combination with a deficiency of its homolog hephaestin causes retinal degeneration and serves as a pathophysiological model for aceruloplasminemia and age-related macular degeneration. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit progressive accumulation of stored iron in the liver, spleen, cerebellum, and brainstem, mild iron deficiency anemia, and impaired motor coordination associated with loss of brainstem dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T G 18: 59,031,929 C1034W probably damaging Het
Agbl2 G T 2: 90,810,745 K737N probably damaging Het
Aqp9 T A 9: 71,112,342 I279F possibly damaging Het
Aspm T A 1: 139,457,117 N166K probably benign Het
Atp13a3 A T 16: 30,357,266 I186N probably benign Het
Btaf1 A T 19: 36,994,962 I1366L probably benign Het
Camk4 A C 18: 33,078,021 K60Q possibly damaging Het
Card11 G T 5: 140,906,633 Q226K possibly damaging Het
Ccdc187 T C 2: 26,293,658 D110G possibly damaging Het
Col5a2 C T 1: 45,407,032 R462Q possibly damaging Het
Cpz A T 5: 35,517,758 V38E probably damaging Het
Cxcr6 G A 9: 123,810,116 V68I probably damaging Het
Cyp2a22 C A 7: 26,934,762 E322D possibly damaging Het
D130052B06Rik C T 11: 33,623,784 T127I probably benign Het
Daam2 T A 17: 49,490,203 M185L possibly damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Dnttip2 T A 3: 122,276,748 S537R probably benign Het
Dock9 G T 14: 121,626,880 H572Q probably benign Het
Dpp4 T A 2: 62,372,869 probably null Het
Enc1 T G 13: 97,245,042 I20S possibly damaging Het
Ephb6 T A 6: 41,619,720 H900Q probably benign Het
Ercc3 T C 18: 32,267,165 V690A possibly damaging Het
Fam90a1a C T 8: 21,963,369 Q247* probably null Het
Fkbp10 G A 11: 100,423,931 R423H probably benign Het
Fus A G 7: 127,981,545 M265V probably benign Het
Gas2l3 T A 10: 89,414,265 K330N probably damaging Het
Gpam T G 19: 55,081,469 L410F probably damaging Het
Gpr37l1 A T 1: 135,161,535 V264E possibly damaging Het
Grk6 A T 13: 55,453,166 probably benign Het
Gsto1 G T 19: 47,855,235 V19F probably damaging Het
H1fnt G T 15: 98,256,135 Q378K unknown Het
Hgfac G A 5: 35,043,674 C194Y probably damaging Het
Hivep1 A G 13: 42,157,931 N1216D probably damaging Het
Hrg C T 16: 22,951,247 A42V probably damaging Het
Irx4 A G 13: 73,266,705 D136G probably benign Het
Kcnn3 G T 3: 89,652,090 V556L probably benign Het
Klk8 T C 7: 43,802,121 Y179H possibly damaging Het
Klrb1f T A 6: 129,054,359 L173* probably null Het
Kremen2 A T 17: 23,743,399 probably null Het
Krt25 A T 11: 99,316,552 Y400* probably null Het
Lingo4 A T 3: 94,403,178 R474S probably benign Het
Lnpep T C 17: 17,553,313 K599E probably benign Het
Mapk8ip3 A T 17: 24,936,850 M2K possibly damaging Het
Mat2b A T 11: 40,680,077 S307T probably benign Het
Mcph1 C A 8: 18,631,963 A372D probably benign Het
Mfsd6 T A 1: 52,709,365 I114F probably damaging Het
Mlkl A G 8: 111,322,748 S248P probably damaging Het
Mmrn1 A T 6: 60,977,101 T789S probably benign Het
Mphosph8 A G 14: 56,693,459 Y735C probably damaging Het
Mrc1 T A 2: 14,257,099 Y300N probably damaging Het
Mrps11 A G 7: 78,792,712 H180R probably damaging Het
Msh4 T C 3: 153,867,767 D556G probably damaging Het
Myh10 C A 11: 68,802,296 D1472E probably benign Het
Myo16 T C 8: 10,442,283 S742P probably damaging Het
Nlrp5-ps C T 7: 14,583,053 noncoding transcript Het
Nrp1 C T 8: 128,468,493 P477S probably benign Het
Olfr1278 T C 2: 111,292,865 V199A probably damaging Het
Olfr1307 T A 2: 111,945,280 M59L probably benign Het
Olfr64 T C 7: 103,892,911 S275G probably benign Het
Olfr936 G T 9: 39,047,382 H57N unknown Het
Oplah G T 15: 76,302,483 C665* probably null Het
Otogl T C 10: 107,783,712 T1696A possibly damaging Het
Pdzrn4 A G 15: 92,401,974 I242V probably benign Het
Phgdh G A 3: 98,328,135 T141I probably benign Het
Pigv T C 4: 133,664,926 Y311C probably damaging Het
Pik3c2a T G 7: 116,418,520 M1L possibly damaging Het
Pitpnm1 A T 19: 4,109,960 K760* probably null Het
Pnrc1 G A 4: 33,246,438 H174Y probably damaging Het
Ptgis A G 2: 167,191,968 probably benign Het
Ptpn4 T C 1: 119,716,043 probably null Het
Rin3 T A 12: 102,369,330 L420* probably null Het
Sacs T G 14: 61,205,454 F1650V probably damaging Het
Sbno2 T A 10: 80,058,508 N1081Y possibly damaging Het
Sema5b C T 16: 35,646,367 P213L probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint6 T A 4: 113,177,037 probably benign Het
Slc4a2 A G 5: 24,429,567 E68G probably damaging Het
Srcin1 C T 11: 97,533,501 V634I probably benign Het
Srsf10 T A 4: 135,863,165 F134I possibly damaging Het
Stab1 C A 14: 31,145,303 G1700V probably damaging Het
Sun1 T G 5: 139,230,789 C290W possibly damaging Het
Svs6 T A 2: 164,317,657 probably benign Het
Tmem8b G A 4: 43,690,228 probably null Het
Usp49 A G 17: 47,672,313 D81G probably damaging Het
Vmn1r215 T A 13: 23,076,678 V296D probably benign Het
Vmn1r6 T A 6: 57,002,622 S90T probably damaging Het
Wbp2 A G 11: 116,083,883 F42L probably benign Het
Wdr20rt C T 12: 65,227,281 T333I possibly damaging Het
Zfp341 C T 2: 154,641,378 A552V probably benign Het
Zfp607b A T 7: 27,692,524 H8L possibly damaging Het
Zfp758 G T 17: 22,375,849 D439Y probably damaging Het
Zfp946 T C 17: 22,453,557 Y46H probably damaging Het
Zic2 G A 14: 122,478,947 E432K probably damaging Het
Other mutations in Cp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cp APN 3 19985662 missense possibly damaging 0.95
IGL00923:Cp APN 3 19970001 missense probably damaging 1.00
IGL01302:Cp APN 3 19966367 missense probably damaging 0.99
IGL01407:Cp APN 3 19977205 missense possibly damaging 0.79
IGL01505:Cp APN 3 19977192 missense possibly damaging 0.83
IGL01677:Cp APN 3 19966434 missense probably damaging 1.00
IGL02013:Cp APN 3 19988049 missense probably damaging 1.00
IGL02114:Cp APN 3 19966347 missense probably benign 0.16
IGL02950:Cp APN 3 19988001 missense probably damaging 0.99
IGL03330:Cp APN 3 19966435 missense probably damaging 1.00
iron10 UTSW 3 19989148 unclassified probably benign
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0320:Cp UTSW 3 19974848 splice site probably benign
R0632:Cp UTSW 3 19971082 missense probably null 0.98
R1103:Cp UTSW 3 19981985 missense possibly damaging 0.82
R1137:Cp UTSW 3 19978952 missense probably benign 0.04
R1199:Cp UTSW 3 19977152 missense probably damaging 1.00
R1523:Cp UTSW 3 19989065 missense probably benign 0.00
R1629:Cp UTSW 3 19966450 critical splice donor site probably null
R1678:Cp UTSW 3 19972717 missense probably damaging 0.99
R1779:Cp UTSW 3 19957385 missense possibly damaging 0.91
R1816:Cp UTSW 3 19968220 splice site probably benign
R1990:Cp UTSW 3 19979013 missense probably damaging 1.00
R2014:Cp UTSW 3 19987434 missense probably benign 0.00
R2179:Cp UTSW 3 19987987 missense probably damaging 1.00
R2249:Cp UTSW 3 19987570 missense probably damaging 1.00
R3440:Cp UTSW 3 19974957 missense probably benign 0.02
R3441:Cp UTSW 3 19974957 missense probably benign 0.02
R3886:Cp UTSW 3 19989111 missense probably damaging 1.00
R3937:Cp UTSW 3 19971034 missense probably damaging 1.00
R4387:Cp UTSW 3 19977202 missense probably damaging 1.00
R4412:Cp UTSW 3 19966353 missense probably damaging 1.00
R4413:Cp UTSW 3 19966353 missense probably damaging 1.00
R4514:Cp UTSW 3 19988013 missense probably damaging 0.99
R4578:Cp UTSW 3 19973888 missense probably damaging 1.00
R4579:Cp UTSW 3 19957435 splice site probably null
R4694:Cp UTSW 3 19974885 missense probably benign 0.07
R4724:Cp UTSW 3 19972647 missense probably benign 0.02
R4910:Cp UTSW 3 19989224 unclassified probably benign
R4960:Cp UTSW 3 19973797 missense probably damaging 0.96
R5043:Cp UTSW 3 19973917 missense probably benign 0.00
R5063:Cp UTSW 3 19989215 missense probably benign 0.27
R5294:Cp UTSW 3 19966316 missense probably benign 0.00
R5382:Cp UTSW 3 19978925 missense probably damaging 1.00
R5404:Cp UTSW 3 19989128 missense possibly damaging 0.92
R5569:Cp UTSW 3 19978877 missense probably damaging 1.00
R5789:Cp UTSW 3 19957290 missense probably benign
R5943:Cp UTSW 3 19964306 missense probably benign 0.11
R6060:Cp UTSW 3 19968072 missense probably damaging 1.00
R6492:Cp UTSW 3 19982022 missense probably benign 0.20
R6540:Cp UTSW 3 19964529 critical splice donor site probably null
R7007:Cp UTSW 3 19969973 missense probably damaging 0.97
R7126:Cp UTSW 3 19980624 missense not run
R7136:Cp UTSW 3 19985658 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccaaaccaaccctgtcttctc -3'
Posted On2014-05-23