Incidental Mutation 'R1733:Stab1'
ID199516
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Namestabilin 1
SynonymsMS-1
MMRRC Submission 039765-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1733 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31139013-31168641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31145303 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 1700 (G1700V)
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618] [ENSMUST00000159249]
Predicted Effect probably damaging
Transcript: ENSMUST00000036618
AA Change: G1700V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: G1700V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159249
SMART Domains Protein: ENSMUSP00000125542
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
EGF 110 147 1.26e-2 SMART
EGF 157 191 1.61e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162763
Meta Mutation Damage Score 0.42 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T G 18: 59,031,929 C1034W probably damaging Het
Agbl2 G T 2: 90,810,745 K737N probably damaging Het
Aqp9 T A 9: 71,112,342 I279F possibly damaging Het
Aspm T A 1: 139,457,117 N166K probably benign Het
Atp13a3 A T 16: 30,357,266 I186N probably benign Het
Btaf1 A T 19: 36,994,962 I1366L probably benign Het
Camk4 A C 18: 33,078,021 K60Q possibly damaging Het
Card11 G T 5: 140,906,633 Q226K possibly damaging Het
Ccdc187 T C 2: 26,293,658 D110G possibly damaging Het
Col5a2 C T 1: 45,407,032 R462Q possibly damaging Het
Cp A T 3: 19,968,219 probably benign Het
Cpz A T 5: 35,517,758 V38E probably damaging Het
Cxcr6 G A 9: 123,810,116 V68I probably damaging Het
Cyp2a22 C A 7: 26,934,762 E322D possibly damaging Het
D130052B06Rik C T 11: 33,623,784 T127I probably benign Het
Daam2 T A 17: 49,490,203 M185L possibly damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Dnttip2 T A 3: 122,276,748 S537R probably benign Het
Dock9 G T 14: 121,626,880 H572Q probably benign Het
Dpp4 T A 2: 62,372,869 probably null Het
Enc1 T G 13: 97,245,042 I20S possibly damaging Het
Ephb6 T A 6: 41,619,720 H900Q probably benign Het
Ercc3 T C 18: 32,267,165 V690A possibly damaging Het
Fam90a1a C T 8: 21,963,369 Q247* probably null Het
Fkbp10 G A 11: 100,423,931 R423H probably benign Het
Fus A G 7: 127,981,545 M265V probably benign Het
Gas2l3 T A 10: 89,414,265 K330N probably damaging Het
Gpam T G 19: 55,081,469 L410F probably damaging Het
Gpr37l1 A T 1: 135,161,535 V264E possibly damaging Het
Grk6 A T 13: 55,453,166 probably benign Het
Gsto1 G T 19: 47,855,235 V19F probably damaging Het
H1fnt G T 15: 98,256,135 Q378K unknown Het
Hgfac G A 5: 35,043,674 C194Y probably damaging Het
Hivep1 A G 13: 42,157,931 N1216D probably damaging Het
Hrg C T 16: 22,951,247 A42V probably damaging Het
Irx4 A G 13: 73,266,705 D136G probably benign Het
Kcnn3 G T 3: 89,652,090 V556L probably benign Het
Klk8 T C 7: 43,802,121 Y179H possibly damaging Het
Klrb1f T A 6: 129,054,359 L173* probably null Het
Kremen2 A T 17: 23,743,399 probably null Het
Krt25 A T 11: 99,316,552 Y400* probably null Het
Lingo4 A T 3: 94,403,178 R474S probably benign Het
Lnpep T C 17: 17,553,313 K599E probably benign Het
Mapk8ip3 A T 17: 24,936,850 M2K possibly damaging Het
Mat2b A T 11: 40,680,077 S307T probably benign Het
Mcph1 C A 8: 18,631,963 A372D probably benign Het
Mfsd6 T A 1: 52,709,365 I114F probably damaging Het
Mlkl A G 8: 111,322,748 S248P probably damaging Het
Mmrn1 A T 6: 60,977,101 T789S probably benign Het
Mphosph8 A G 14: 56,693,459 Y735C probably damaging Het
Mrc1 T A 2: 14,257,099 Y300N probably damaging Het
Mrps11 A G 7: 78,792,712 H180R probably damaging Het
Msh4 T C 3: 153,867,767 D556G probably damaging Het
Myh10 C A 11: 68,802,296 D1472E probably benign Het
Myo16 T C 8: 10,442,283 S742P probably damaging Het
Nlrp5-ps C T 7: 14,583,053 noncoding transcript Het
Nrp1 C T 8: 128,468,493 P477S probably benign Het
Olfr1278 T C 2: 111,292,865 V199A probably damaging Het
Olfr1307 T A 2: 111,945,280 M59L probably benign Het
Olfr64 T C 7: 103,892,911 S275G probably benign Het
Olfr936 G T 9: 39,047,382 H57N unknown Het
Oplah G T 15: 76,302,483 C665* probably null Het
Otogl T C 10: 107,783,712 T1696A possibly damaging Het
Pdzrn4 A G 15: 92,401,974 I242V probably benign Het
Phgdh G A 3: 98,328,135 T141I probably benign Het
Pigv T C 4: 133,664,926 Y311C probably damaging Het
Pik3c2a T G 7: 116,418,520 M1L possibly damaging Het
Pitpnm1 A T 19: 4,109,960 K760* probably null Het
Pnrc1 G A 4: 33,246,438 H174Y probably damaging Het
Ptgis A G 2: 167,191,968 probably benign Het
Ptpn4 T C 1: 119,716,043 probably null Het
Rin3 T A 12: 102,369,330 L420* probably null Het
Sacs T G 14: 61,205,454 F1650V probably damaging Het
Sbno2 T A 10: 80,058,508 N1081Y possibly damaging Het
Sema5b C T 16: 35,646,367 P213L probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint6 T A 4: 113,177,037 probably benign Het
Slc4a2 A G 5: 24,429,567 E68G probably damaging Het
Srcin1 C T 11: 97,533,501 V634I probably benign Het
Srsf10 T A 4: 135,863,165 F134I possibly damaging Het
Sun1 T G 5: 139,230,789 C290W possibly damaging Het
Svs6 T A 2: 164,317,657 probably benign Het
Tmem8b G A 4: 43,690,228 probably null Het
Usp49 A G 17: 47,672,313 D81G probably damaging Het
Vmn1r215 T A 13: 23,076,678 V296D probably benign Het
Vmn1r6 T A 6: 57,002,622 S90T probably damaging Het
Wbp2 A G 11: 116,083,883 F42L probably benign Het
Wdr20rt C T 12: 65,227,281 T333I possibly damaging Het
Zfp341 C T 2: 154,641,378 A552V probably benign Het
Zfp607b A T 7: 27,692,524 H8L possibly damaging Het
Zfp758 G T 17: 22,375,849 D439Y probably damaging Het
Zfp946 T C 17: 22,453,557 Y46H probably damaging Het
Zic2 G A 14: 122,478,947 E432K probably damaging Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31161357 missense probably benign 0.01
IGL00323:Stab1 APN 14 31139306 missense probably benign 0.04
IGL00515:Stab1 APN 14 31159729 missense probably benign 0.20
IGL00844:Stab1 APN 14 31147066 missense probably damaging 1.00
IGL01374:Stab1 APN 14 31147075 missense probably damaging 1.00
IGL01384:Stab1 APN 14 31150408 missense probably benign
IGL01431:Stab1 APN 14 31148995 missense probably benign 0.06
IGL01787:Stab1 APN 14 31139808 missense probably damaging 1.00
IGL02128:Stab1 APN 14 31150441 missense probably damaging 1.00
IGL02138:Stab1 APN 14 31143513 critical splice donor site probably null
IGL02256:Stab1 APN 14 31141592 missense probably damaging 1.00
IGL02340:Stab1 APN 14 31140410 missense probably damaging 0.96
IGL02507:Stab1 APN 14 31139210 unclassified probably benign
IGL02695:Stab1 APN 14 31159271 missense probably damaging 1.00
IGL02755:Stab1 APN 14 31139638 missense probably benign 0.01
IGL02870:Stab1 APN 14 31139397 missense probably benign 0.00
IGL02884:Stab1 APN 14 31150143 splice site probably null
IGL03035:Stab1 APN 14 31147769 missense probably benign 0.00
IGL03267:Stab1 APN 14 31142729 missense probably damaging 1.00
IGL03286:Stab1 APN 14 31159326 splice site probably benign
IGL03366:Stab1 APN 14 31150263 missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31154407 missense probably benign 0.42
IGL02835:Stab1 UTSW 14 31146024 critical splice donor site probably null
K7371:Stab1 UTSW 14 31150249 missense probably damaging 1.00
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0363:Stab1 UTSW 14 31159008 splice site probably benign
R0387:Stab1 UTSW 14 31148101 missense probably benign 0.00
R0391:Stab1 UTSW 14 31143418 missense probably benign 0.21
R0513:Stab1 UTSW 14 31148945 missense probably benign 0.08
R0546:Stab1 UTSW 14 31139550 missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31152600 missense probably benign 0.16
R0906:Stab1 UTSW 14 31145249 missense probably benign 0.19
R0963:Stab1 UTSW 14 31147274 missense probably damaging 0.97
R1219:Stab1 UTSW 14 31140621 unclassified probably null
R1234:Stab1 UTSW 14 31150236 missense probably damaging 1.00
R1260:Stab1 UTSW 14 31151889 missense probably damaging 1.00
R1400:Stab1 UTSW 14 31139830 missense possibly damaging 0.92
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1440:Stab1 UTSW 14 31151690 nonsense probably null
R1472:Stab1 UTSW 14 31141586 missense probably benign 0.01
R1474:Stab1 UTSW 14 31149861 missense probably benign 0.45
R1475:Stab1 UTSW 14 31163828 missense probably benign
R1509:Stab1 UTSW 14 31151584 splice site probably benign
R1551:Stab1 UTSW 14 31160499 missense probably benign 0.00
R1572:Stab1 UTSW 14 31150823 missense probably damaging 1.00
R1633:Stab1 UTSW 14 31150380 intron probably null
R1719:Stab1 UTSW 14 31146028 nonsense probably null
R1763:Stab1 UTSW 14 31168416 missense probably benign 0.04
R1808:Stab1 UTSW 14 31141144 missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31157465 missense probably benign 0.03
R1853:Stab1 UTSW 14 31140463 missense probably damaging 1.00
R1891:Stab1 UTSW 14 31141330 missense probably benign 0.07
R1984:Stab1 UTSW 14 31150648 missense probably benign 0.20
R1998:Stab1 UTSW 14 31162153 nonsense probably null
R2165:Stab1 UTSW 14 31168435 missense probably benign 0.20
R2191:Stab1 UTSW 14 31142800 missense probably benign 0.03
R2191:Stab1 UTSW 14 31159270 missense probably damaging 1.00
R2233:Stab1 UTSW 14 31161880 missense probably benign 0.08
R2303:Stab1 UTSW 14 31146070 missense probably damaging 1.00
R2496:Stab1 UTSW 14 31161463 missense probably damaging 1.00
R2504:Stab1 UTSW 14 31163040 critical splice donor site probably null
R2519:Stab1 UTSW 14 31154872 missense probably damaging 1.00
R2926:Stab1 UTSW 14 31161799 missense probably damaging 1.00
R4025:Stab1 UTSW 14 31154952 missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31168479 missense probably damaging 0.98
R4258:Stab1 UTSW 14 31154672 missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31157445 missense probably benign 0.01
R4644:Stab1 UTSW 14 31140487 unclassified probably benign
R4660:Stab1 UTSW 14 31154915 missense possibly damaging 0.91
R4801:Stab1 UTSW 14 31141371 nonsense probably null
R4802:Stab1 UTSW 14 31141371 nonsense probably null
R4870:Stab1 UTSW 14 31142043 missense probably benign 0.13
R4872:Stab1 UTSW 14 31140393 missense probably damaging 1.00
R4881:Stab1 UTSW 14 31143672 missense probably benign 0.32
R4941:Stab1 UTSW 14 31151571 missense probably benign 0.00
R5061:Stab1 UTSW 14 31163099 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31143624 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5087:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5092:Stab1 UTSW 14 31145855 missense probably benign 0.01
R5102:Stab1 UTSW 14 31148017 critical splice donor site probably null
R5107:Stab1 UTSW 14 31163795 splice site probably null
R5195:Stab1 UTSW 14 31140521 unclassified probably benign
R5217:Stab1 UTSW 14 31159519 missense probably benign 0.25
R5285:Stab1 UTSW 14 31143476 unclassified probably benign
R5327:Stab1 UTSW 14 31161836 nonsense probably null
R5647:Stab1 UTSW 14 31157440 nonsense probably null
R5696:Stab1 UTSW 14 31160221 missense probably benign
R5996:Stab1 UTSW 14 31139551 missense probably benign 0.39
R6016:Stab1 UTSW 14 31158993 missense probably damaging 1.00
R6017:Stab1 UTSW 14 31141544 missense probably benign 0.00
R6174:Stab1 UTSW 14 31162519 nonsense probably null
R6366:Stab1 UTSW 14 31141438 missense probably benign 0.10
R6754:Stab1 UTSW 14 31141081 missense probably benign
R6788:Stab1 UTSW 14 31139160 missense probably damaging 1.00
R6898:Stab1 UTSW 14 31158963 missense probably benign 0.00
R7124:Stab1 UTSW 14 31160867 missense not run
R7145:Stab1 UTSW 14 31145073 critical splice donor site unknown
R7153:Stab1 UTSW 14 31160584 missense not run
X0026:Stab1 UTSW 14 31162191 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCAGCGGCAGTGACATTTCTC -3'
(R):5'- ATGGAAGCCCTACCACCTGTCTTG -3'

Sequencing Primer
(F):5'- CAGTGACATTTCTCTGGGAAAG -3'
(R):5'- GACTCTGCCCTTGACCAAC -3'
Posted On2014-05-23