Incidental Mutation 'R1733:Mapk8ip3'
ID199532
Institutional Source Beutler Lab
Gene Symbol Mapk8ip3
Ensembl Gene ENSMUSG00000024163
Gene Namemitogen-activated protein kinase 8 interacting protein 3
SynonymsJSAP1, Syd2, JNK-interacting protein 3, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1, D17Wsu15e, Jip3, JSAP1a, JSAP1b, JSAP1c, sunday driver 2, JSAP1d, JUN/SAPK-associated protein 1
MMRRC Submission 039765-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.745) question?
Stock #R1733 (G1)
Quality Score175
Status Validated
Chromosome17
Chromosomal Location24892153-24936977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24936850 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 2 (M2K)
Ref Sequence ENSEMBL: ENSMUSP00000114802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088345] [ENSMUST00000115228] [ENSMUST00000115229] [ENSMUST00000117509] [ENSMUST00000119115] [ENSMUST00000120035] [ENSMUST00000121723] [ENSMUST00000121787] [ENSMUST00000146923] [ENSMUST00000178969]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088345
AA Change: M2K

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085683
Gene: ENSMUSG00000024163
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115228
AA Change: M2K

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110883
Gene: ENSMUSG00000024163
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 411 466 7e-20 PDB
low complexity region 567 581 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
SCOP:d1flga_ 972 1152 3e-8 SMART
Blast:WD40 1060 1101 6e-18 BLAST
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115229
AA Change: M2K

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110884
Gene: ENSMUSG00000024163
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 184 2.9e-60 PFAM
low complexity region 244 257 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:JIP_LZII 423 493 3.1e-32 PFAM
coiled coil region 533 563 N/A INTRINSIC
low complexity region 590 604 N/A INTRINSIC
low complexity region 762 777 N/A INTRINSIC
low complexity region 901 909 N/A INTRINSIC
low complexity region 936 948 N/A INTRINSIC
SCOP:d1flga_ 995 1175 4e-8 SMART
Blast:WD40 1083 1124 7e-18 BLAST
low complexity region 1268 1284 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117509
AA Change: M2K

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112712
Gene: ENSMUSG00000024163
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 238 247 N/A INTRINSIC
PDB:2W83|D 394 449 7e-20 PDB
coiled coil region 502 532 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 731 746 N/A INTRINSIC
low complexity region 870 878 N/A INTRINSIC
low complexity region 905 917 N/A INTRINSIC
SCOP:d1flga_ 964 1144 3e-8 SMART
Blast:WD40 1052 1093 6e-18 BLAST
low complexity region 1237 1253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119115
AA Change: M2K

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112955
Gene: ENSMUSG00000024163
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.3e-72 PFAM
low complexity region 229 238 N/A INTRINSIC
PDB:2W83|D 385 440 7e-20 PDB
coiled coil region 493 523 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 861 869 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
SCOP:d1flga_ 955 1135 3e-8 SMART
Blast:WD40 1043 1084 5e-18 BLAST
low complexity region 1228 1244 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120035
AA Change: M2K

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114084
Gene: ENSMUSG00000024163
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 235 248 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
PDB:2W83|D 416 471 6e-20 PDB
coiled coil region 524 554 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 892 900 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
SCOP:d1flga_ 986 1166 3e-8 SMART
Blast:WD40 1074 1115 6e-18 BLAST
low complexity region 1259 1275 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121723
AA Change: M2K

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113698
Gene: ENSMUSG00000024163
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1e-72 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 386 441 7e-20 PDB
coiled coil region 494 524 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 862 870 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
SCOP:d1flga_ 956 1136 3e-8 SMART
Blast:WD40 1044 1085 5e-18 BLAST
low complexity region 1229 1245 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121787
AA Change: M2K

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113753
Gene: ENSMUSG00000024163
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 3.8e-73 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 380 435 8e-20 PDB
coiled coil region 488 518 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 856 864 N/A INTRINSIC
low complexity region 891 903 N/A INTRINSIC
SCOP:d1flga_ 950 1130 3e-8 SMART
Blast:WD40 1038 1079 6e-18 BLAST
low complexity region 1223 1239 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146923
AA Change: M2K

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114802
Gene: ENSMUSG00000024163
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148360
Predicted Effect probably benign
Transcript: ENSMUST00000178969
AA Change: M2K

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136924
Gene: ENSMUSG00000024163
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.1e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 3e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the product of Drosophila syd gene, required for the functional interaction of kinesin I with axonal cargo. Studies of the similar gene in mouse suggested that this protein may interact with, and regulate the activity of numerous protein kinases of the JNK signaling pathway, and thus function as a scaffold protein in neuronal cells. The C. elegans counterpart of this gene is found to regulate synaptic vesicle transport possibly by integrating JNK signaling and kinesin-1 transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in impaired lung morphogenesis, causes absence of the telencephalic commissure with multiple defects in brain development and axon guidance, may affect synaptic transmission, and invariably leads to neonatal death due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T G 18: 59,031,929 C1034W probably damaging Het
Agbl2 G T 2: 90,810,745 K737N probably damaging Het
Aqp9 T A 9: 71,112,342 I279F possibly damaging Het
Aspm T A 1: 139,457,117 N166K probably benign Het
Atp13a3 A T 16: 30,357,266 I186N probably benign Het
Btaf1 A T 19: 36,994,962 I1366L probably benign Het
Camk4 A C 18: 33,078,021 K60Q possibly damaging Het
Card11 G T 5: 140,906,633 Q226K possibly damaging Het
Ccdc187 T C 2: 26,293,658 D110G possibly damaging Het
Col5a2 C T 1: 45,407,032 R462Q possibly damaging Het
Cp A T 3: 19,968,219 probably benign Het
Cpz A T 5: 35,517,758 V38E probably damaging Het
Cxcr6 G A 9: 123,810,116 V68I probably damaging Het
Cyp2a22 C A 7: 26,934,762 E322D possibly damaging Het
D130052B06Rik C T 11: 33,623,784 T127I probably benign Het
Daam2 T A 17: 49,490,203 M185L possibly damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Dnttip2 T A 3: 122,276,748 S537R probably benign Het
Dock9 G T 14: 121,626,880 H572Q probably benign Het
Dpp4 T A 2: 62,372,869 probably null Het
Enc1 T G 13: 97,245,042 I20S possibly damaging Het
Ephb6 T A 6: 41,619,720 H900Q probably benign Het
Ercc3 T C 18: 32,267,165 V690A possibly damaging Het
Fam90a1a C T 8: 21,963,369 Q247* probably null Het
Fkbp10 G A 11: 100,423,931 R423H probably benign Het
Fus A G 7: 127,981,545 M265V probably benign Het
Gas2l3 T A 10: 89,414,265 K330N probably damaging Het
Gpam T G 19: 55,081,469 L410F probably damaging Het
Gpr37l1 A T 1: 135,161,535 V264E possibly damaging Het
Grk6 A T 13: 55,453,166 probably benign Het
Gsto1 G T 19: 47,855,235 V19F probably damaging Het
H1fnt G T 15: 98,256,135 Q378K unknown Het
Hgfac G A 5: 35,043,674 C194Y probably damaging Het
Hivep1 A G 13: 42,157,931 N1216D probably damaging Het
Hrg C T 16: 22,951,247 A42V probably damaging Het
Irx4 A G 13: 73,266,705 D136G probably benign Het
Kcnn3 G T 3: 89,652,090 V556L probably benign Het
Klk8 T C 7: 43,802,121 Y179H possibly damaging Het
Klrb1f T A 6: 129,054,359 L173* probably null Het
Kremen2 A T 17: 23,743,399 probably null Het
Krt25 A T 11: 99,316,552 Y400* probably null Het
Lingo4 A T 3: 94,403,178 R474S probably benign Het
Lnpep T C 17: 17,553,313 K599E probably benign Het
Mat2b A T 11: 40,680,077 S307T probably benign Het
Mcph1 C A 8: 18,631,963 A372D probably benign Het
Mfsd6 T A 1: 52,709,365 I114F probably damaging Het
Mlkl A G 8: 111,322,748 S248P probably damaging Het
Mmrn1 A T 6: 60,977,101 T789S probably benign Het
Mphosph8 A G 14: 56,693,459 Y735C probably damaging Het
Mrc1 T A 2: 14,257,099 Y300N probably damaging Het
Mrps11 A G 7: 78,792,712 H180R probably damaging Het
Msh4 T C 3: 153,867,767 D556G probably damaging Het
Myh10 C A 11: 68,802,296 D1472E probably benign Het
Myo16 T C 8: 10,442,283 S742P probably damaging Het
Nlrp5-ps C T 7: 14,583,053 noncoding transcript Het
Nrp1 C T 8: 128,468,493 P477S probably benign Het
Olfr1278 T C 2: 111,292,865 V199A probably damaging Het
Olfr1307 T A 2: 111,945,280 M59L probably benign Het
Olfr64 T C 7: 103,892,911 S275G probably benign Het
Olfr936 G T 9: 39,047,382 H57N unknown Het
Oplah G T 15: 76,302,483 C665* probably null Het
Otogl T C 10: 107,783,712 T1696A possibly damaging Het
Pdzrn4 A G 15: 92,401,974 I242V probably benign Het
Phgdh G A 3: 98,328,135 T141I probably benign Het
Pigv T C 4: 133,664,926 Y311C probably damaging Het
Pik3c2a T G 7: 116,418,520 M1L possibly damaging Het
Pitpnm1 A T 19: 4,109,960 K760* probably null Het
Pnrc1 G A 4: 33,246,438 H174Y probably damaging Het
Ptgis A G 2: 167,191,968 probably benign Het
Ptpn4 T C 1: 119,716,043 probably null Het
Rin3 T A 12: 102,369,330 L420* probably null Het
Sacs T G 14: 61,205,454 F1650V probably damaging Het
Sbno2 T A 10: 80,058,508 N1081Y possibly damaging Het
Sema5b C T 16: 35,646,367 P213L probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint6 T A 4: 113,177,037 probably benign Het
Slc4a2 A G 5: 24,429,567 E68G probably damaging Het
Srcin1 C T 11: 97,533,501 V634I probably benign Het
Srsf10 T A 4: 135,863,165 F134I possibly damaging Het
Stab1 C A 14: 31,145,303 G1700V probably damaging Het
Sun1 T G 5: 139,230,789 C290W possibly damaging Het
Svs6 T A 2: 164,317,657 probably benign Het
Tmem8b G A 4: 43,690,228 probably null Het
Usp49 A G 17: 47,672,313 D81G probably damaging Het
Vmn1r215 T A 13: 23,076,678 V296D probably benign Het
Vmn1r6 T A 6: 57,002,622 S90T probably damaging Het
Wbp2 A G 11: 116,083,883 F42L probably benign Het
Wdr20rt C T 12: 65,227,281 T333I possibly damaging Het
Zfp341 C T 2: 154,641,378 A552V probably benign Het
Zfp607b A T 7: 27,692,524 H8L possibly damaging Het
Zfp758 G T 17: 22,375,849 D439Y probably damaging Het
Zfp946 T C 17: 22,453,557 Y46H probably damaging Het
Zic2 G A 14: 122,478,947 E432K probably damaging Het
Other mutations in Mapk8ip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Mapk8ip3 APN 17 24900819 missense probably damaging 1.00
IGL01018:Mapk8ip3 APN 17 24899719 splice site probably benign
IGL01066:Mapk8ip3 APN 17 24901718 missense probably benign 0.00
IGL01656:Mapk8ip3 APN 17 24918029 missense probably damaging 0.99
IGL01991:Mapk8ip3 APN 17 24927861 missense possibly damaging 0.78
IGL02014:Mapk8ip3 APN 17 24903280 splice site probably benign
IGL02219:Mapk8ip3 APN 17 24899558 missense probably damaging 1.00
IGL03006:Mapk8ip3 APN 17 24901515 missense probably benign
ANU74:Mapk8ip3 UTSW 17 24900577 missense possibly damaging 0.94
FR4737:Mapk8ip3 UTSW 17 24902119 intron probably null
R0028:Mapk8ip3 UTSW 17 24904897 splice site probably benign
R0401:Mapk8ip3 UTSW 17 24909171 intron probably benign
R0496:Mapk8ip3 UTSW 17 24914450 splice site probably benign
R1456:Mapk8ip3 UTSW 17 24906949 missense probably damaging 1.00
R1503:Mapk8ip3 UTSW 17 24904923 missense probably damaging 1.00
R1554:Mapk8ip3 UTSW 17 24903059 missense probably benign 0.14
R1680:Mapk8ip3 UTSW 17 24901011 missense probably damaging 1.00
R1741:Mapk8ip3 UTSW 17 24899854 missense probably damaging 1.00
R1750:Mapk8ip3 UTSW 17 24914459 missense probably null 1.00
R1774:Mapk8ip3 UTSW 17 24924145 critical splice donor site probably null
R1845:Mapk8ip3 UTSW 17 24914583 missense probably benign 0.29
R1911:Mapk8ip3 UTSW 17 24904051 missense probably benign 0.00
R1993:Mapk8ip3 UTSW 17 24914588 missense probably damaging 1.00
R2512:Mapk8ip3 UTSW 17 24914703 nonsense probably null
R2656:Mapk8ip3 UTSW 17 24912807 missense probably damaging 1.00
R2990:Mapk8ip3 UTSW 17 24905292 missense probably benign 0.00
R4587:Mapk8ip3 UTSW 17 24904787 missense probably damaging 1.00
R4617:Mapk8ip3 UTSW 17 24904787 missense probably damaging 1.00
R4627:Mapk8ip3 UTSW 17 24903293 missense probably benign
R4649:Mapk8ip3 UTSW 17 24904752 missense probably damaging 1.00
R4868:Mapk8ip3 UTSW 17 24901415 missense probably benign 0.04
R4903:Mapk8ip3 UTSW 17 24901209 missense probably benign
R4915:Mapk8ip3 UTSW 17 24909153 missense possibly damaging 0.75
R5447:Mapk8ip3 UTSW 17 24899189 missense probably benign
R5642:Mapk8ip3 UTSW 17 24903311 missense possibly damaging 0.63
R6320:Mapk8ip3 UTSW 17 24906905 missense probably damaging 0.99
X0024:Mapk8ip3 UTSW 17 24903973 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CACCTCCTCGTCATAGCAGTGAATG -3'
(R):5'- ACTCCAATCAGACTGAGCTACGTCC -3'

Sequencing Primer
(F):5'- TGAATGAGGCGCTCGAACTC -3'
(R):5'- AGCCGGAAACGTTCCTTTAG -3'
Posted On2014-05-23