Incidental Mutation 'R1734:Pepd'
ID199568
Institutional Source Beutler Lab
Gene Symbol Pepd
Ensembl Gene ENSMUSG00000063931
Gene Namepeptidase D
SynonymsPep4, Pep-4, dal, peptidase D
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location34912379-35044708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35031426 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 301 (D301V)
Ref Sequence ENSEMBL: ENSMUSP00000075683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075068]
Predicted Effect probably benign
Transcript: ENSMUST00000075068
AA Change: D301V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075683
Gene: ENSMUSG00000063931
AA Change: D301V

DomainStartEndE-ValueType
AMP_N 18 155 2.71e-39 SMART
Pfam:Peptidase_M24 193 459 5.4e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161128
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants are smaller than normal siblings and, except on the flanks, an agouti coat appears nonagouti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Pepd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pepd APN 7 34924440 missense probably benign
IGL02102:Pepd APN 7 34945603 missense probably damaging 1.00
R1256:Pepd UTSW 7 34921492 missense possibly damaging 0.95
R1690:Pepd UTSW 7 35031357 missense probably damaging 1.00
R1911:Pepd UTSW 7 34934749 splice site probably benign
R1918:Pepd UTSW 7 34971676 missense probably benign 0.00
R2144:Pepd UTSW 7 34921418 missense probably benign 0.09
R4814:Pepd UTSW 7 34945597 missense probably damaging 0.96
R4924:Pepd UTSW 7 35020984 missense probably benign 0.24
R5490:Pepd UTSW 7 34942690 splice site probably null
R5669:Pepd UTSW 7 35040674 missense probably benign 0.38
R6240:Pepd UTSW 7 35021751 missense probably benign 0.00
R6300:Pepd UTSW 7 34969543 missense probably damaging 1.00
R6479:Pepd UTSW 7 35040722 missense probably benign 0.00
R6995:Pepd UTSW 7 35021719 missense probably damaging 1.00
X0021:Pepd UTSW 7 34954563 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGGCCAGGCTTCTTCCTTAG -3'
(R):5'- CCTGCGGTGTCTGTCAGTCAAG -3'

Sequencing Primer
(F):5'- tgagattgtgggggaggg -3'
(R):5'- CAGTCAAGATGTATGTTCAGTCCC -3'
Posted On2014-05-23