Incidental Mutation 'R1734:Cherp'
ID199573
Institutional Source Beutler Lab
Gene Symbol Cherp
Ensembl Gene ENSMUSG00000052488
Gene Namecalcium homeostasis endoplasmic reticulum protein
SynonymsDAN16, SCAF6, D8Wsu96e, 5730408I11Rik
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72460489-72475226 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 72470088 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079510] [ENSMUST00000212991]
Predicted Effect probably null
Transcript: ENSMUST00000079510
SMART Domains Protein: ENSMUSP00000078469
Gene: ENSMUSG00000052488

DomainStartEndE-ValueType
SWAP 13 65 9.76e-24 SMART
low complexity region 78 100 N/A INTRINSIC
low complexity region 107 124 N/A INTRINSIC
RPR 156 286 5.32e-2 SMART
coiled coil region 310 334 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
low complexity region 439 463 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 526 560 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
low complexity region 743 829 N/A INTRINSIC
G_patch 850 900 9.8e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212870
Predicted Effect probably null
Transcript: ENSMUST00000212991
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Cherp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cherp APN 8 72468246 missense probably damaging 0.97
IGL00955:Cherp APN 8 72470194 missense probably damaging 0.99
R0452:Cherp UTSW 8 72461522 unclassified probably benign
R0479:Cherp UTSW 8 72463147 missense possibly damaging 0.66
R0594:Cherp UTSW 8 72462402 critical splice donor site probably null
R1781:Cherp UTSW 8 72467771 missense probably damaging 1.00
R1793:Cherp UTSW 8 72463150 missense probably benign 0.12
R2012:Cherp UTSW 8 72474769 missense probably damaging 0.98
R2845:Cherp UTSW 8 72466403 missense probably damaging 0.99
R3612:Cherp UTSW 8 72461996 unclassified probably benign
R3693:Cherp UTSW 8 72467911 small deletion probably benign
R3899:Cherp UTSW 8 72469936 missense possibly damaging 0.63
R3900:Cherp UTSW 8 72469936 missense possibly damaging 0.63
R3970:Cherp UTSW 8 72469951 missense possibly damaging 0.60
R4915:Cherp UTSW 8 72468397 missense probably damaging 1.00
R5512:Cherp UTSW 8 72463266 missense possibly damaging 0.66
R5556:Cherp UTSW 8 72467980 missense probably damaging 0.99
R5739:Cherp UTSW 8 72467815 small deletion probably benign
R5768:Cherp UTSW 8 72463113 missense probably damaging 0.98
R5824:Cherp UTSW 8 72462258 unclassified probably benign
R5963:Cherp UTSW 8 72461535 unclassified probably benign
R6255:Cherp UTSW 8 72470881 missense probably damaging 0.99
T0722:Cherp UTSW 8 72462034 small deletion probably benign
T0975:Cherp UTSW 8 72462034 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGTGTGCAAGTGCAGCAAG -3'
(R):5'- TTTTCCCAGGAGCAAGTAACGACAG -3'

Sequencing Primer
(F):5'- AGTACTTACCAGTGGTGCAGC -3'
(R):5'- GCAAGTAACGACAGCCGTG -3'
Posted On2014-05-23