Incidental Mutation 'R1735:Aph1a'
ID199619
Institutional Source Beutler Lab
Gene Symbol Aph1a
Ensembl Gene ENSMUSG00000015750
Gene Nameaph1 homolog A, gamma secretase subunit
Synonyms6530402N02Rik
MMRRC Submission 039767-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1735 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95893969-95898288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95895509 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 140 (D140E)
Ref Sequence ENSEMBL: ENSMUSP00000058846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015894] [ENSMUST00000036181] [ENSMUST00000036360] [ENSMUST00000056710] [ENSMUST00000090476] [ENSMUST00000147962] [ENSMUST00000171519] [ENSMUST00000197081]
Predicted Effect probably damaging
Transcript: ENSMUST00000015894
AA Change: D140E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015894
Gene: ENSMUSG00000015750
AA Change: D140E

DomainStartEndE-ValueType
Pfam:Aph-1 2 246 7.3e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036181
SMART Domains Protein: ENSMUSP00000036983
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 22 278 2.43e-123 SMART
transmembrane domain 290 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056710
AA Change: D140E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058846
Gene: ENSMUSG00000015750
AA Change: D140E

DomainStartEndE-ValueType
Pfam:Aph-1 2 239 1.2e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145949
Predicted Effect probably benign
Transcript: ENSMUST00000147962
SMART Domains Protein: ENSMUSP00000117464
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 8 171 1.79e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197232
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.0%
  • 10x: 95.3%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the gamma-secretase complex, which is localized to the endoplasmic reticulum and golgi apparatus. Gamma-secretase is a multi-protein enzyme that catalyzes intramembraneous proteolysis of type I transmembrane proteins and is essential for many signaling pathways, including the Notch signaling pathway. Studies suggest that the protein encoded by this locus binds directly to substrates of the gamma-secretase complex, including the beta-amyloid precursor protein which is associated with Alzheimer disease progression. This gene is required for normal embryonic development and survival, and disruption is associated with defects in the yolk sack angiogenesis, neural tube formation, and somitogenesis. A pseudogene of this gene is located on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous null embryos die by E11, are severely growth retarded by E9.5 and display defects in somite patterning, branchial arch and heart chamber development, vascular morphogenesis of the yolk sac and have distended pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A C 9: 8,027,265 S91A probably benign Het
Acot5 A T 12: 84,075,487 I282F probably benign Het
Adam19 C A 11: 46,138,917 Q730K probably benign Het
Adgrv1 A G 13: 81,487,947 V3481A possibly damaging Het
Akr1c20 T C 13: 4,487,208 D316G probably benign Het
Ap3b1 G A 13: 94,493,717 V827I unknown Het
Arhgef19 G T 4: 141,249,618 V502L possibly damaging Het
Arl9 T C 5: 77,006,626 F67S probably damaging Het
B430305J03Rik G A 3: 61,363,940 probably benign Het
B4galnt2 A G 11: 95,890,983 F119L probably damaging Het
Bcap29 T A 12: 31,630,840 N49I probably damaging Het
C77080 G T 4: 129,223,577 S476R probably damaging Het
Capn11 T A 17: 45,632,401 K616* probably null Het
Cdh12 T A 15: 21,520,366 Y306N probably damaging Het
Cep350 T A 1: 155,953,214 N315Y probably damaging Het
Cited2 C A 10: 17,724,046 P34Q probably damaging Het
Cmya5 A T 13: 93,089,789 D2930E probably benign Het
Cog3 T A 14: 75,729,321 K470* probably null Het
Commd10 A G 18: 46,990,485 T136A probably benign Het
Csf2ra C A 19: 61,226,344 D181Y probably damaging Het
Csmd1 T A 8: 15,932,610 I2686F probably damaging Het
Dhx29 T C 13: 112,945,086 S415P probably benign Het
Dsel A T 1: 111,860,915 F630Y probably damaging Het
Ell T A 8: 70,578,940 I96N possibly damaging Het
Ephx2 T A 14: 66,088,303 I358L probably benign Het
Fam162b A G 10: 51,587,211 I120T probably damaging Het
Fam187a T C 11: 102,885,780 Y137H probably damaging Het
Fastk T C 5: 24,441,803 E403G probably damaging Het
Fcrlb C A 1: 170,907,332 V409F probably benign Het
Flot2 G T 11: 78,058,005 A269S probably benign Het
Gpd2 T A 2: 57,355,551 N419K probably damaging Het
Hecw1 A T 13: 14,377,765 M61K probably null Het
Htr2a T C 14: 74,706,128 F383L probably damaging Het
Kctd6 C T 14: 8,222,253 R32C probably damaging Het
Khdc1a A G 1: 21,350,965 T125A probably benign Het
Klhl40 T C 9: 121,779,938 S390P probably benign Het
Lonp1 G A 17: 56,614,956 T808I probably damaging Het
Loxhd1 A C 18: 77,404,889 D1342A probably damaging Het
Lrat T C 3: 82,897,110 I187V probably benign Het
Lrif1 T C 3: 106,735,846 *238Q probably null Het
Lrp2bp T C 8: 46,011,988 F48S probably benign Het
Mafg A G 11: 120,629,678 M32T possibly damaging Het
Map4 C T 9: 110,034,955 T416I probably benign Het
N4bp2 T C 5: 65,808,316 F1236S probably damaging Het
Nfatc3 A G 8: 106,083,834 D414G probably damaging Het
Nrip2 T G 6: 128,405,074 V50G probably damaging Het
Olfr1449 T A 19: 12,934,843 I35N probably damaging Het
Olfr16 A G 1: 172,956,807 N4S probably benign Het
Olfr432 A T 1: 174,050,799 K142I probably benign Het
Olfr608 T A 7: 103,470,146 F36I possibly damaging Het
Pcdhb18 A T 18: 37,490,769 H384L probably benign Het
Pik3r1 A T 13: 101,686,374 Y607N probably damaging Het
Plagl2 G A 2: 153,232,477 T168I probably damaging Het
Polr2a A G 11: 69,742,396 S912P probably damaging Het
Ppp1r16b A G 2: 158,761,495 K447E possibly damaging Het
Prkd1 T C 12: 50,342,039 E907G possibly damaging Het
Rabep2 A G 7: 126,444,540 R470G probably damaging Het
Rasal2 T C 1: 157,174,160 Y518C probably damaging Het
Rbmxl1 A G 8: 78,506,082 Y211H probably damaging Het
Rdh7 T C 10: 127,884,585 Y306C probably benign Het
Rtn3 T C 19: 7,457,911 I220V probably damaging Het
Scn8a A G 15: 101,015,861 N1045D possibly damaging Het
Scube1 T C 15: 83,607,437 H952R probably damaging Het
Sf3b1 A G 1: 55,000,652 I690T probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint5 A G 4: 113,563,459 I1108T unknown Het
Snip1 A G 4: 125,071,201 D133G probably benign Het
St3gal3 T C 4: 118,014,774 Y77C probably damaging Het
Sytl3 T C 17: 6,715,481 V112A probably benign Het
Tnxb C T 17: 34,717,970 P3718S probably damaging Het
Ttc24 A T 3: 88,073,094 probably null Het
Ubr3 A T 2: 70,009,129 E1529V probably damaging Het
Utrn T A 10: 12,710,138 H965L probably benign Het
Xrn2 T A 2: 147,061,423 L781Q probably damaging Het
Zbtb11 T C 16: 55,990,682 I401T probably benign Het
Zc3h14 C T 12: 98,758,580 P167L probably damaging Het
Zfp609 G T 9: 65,703,092 S863* probably null Het
Other mutations in Aph1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Aph1a APN 3 95895813 missense probably damaging 0.99
R1675:Aph1a UTSW 3 95894899 missense possibly damaging 0.96
R1872:Aph1a UTSW 3 95895564 missense probably damaging 1.00
R2356:Aph1a UTSW 3 95894232 missense probably benign 0.24
R3942:Aph1a UTSW 3 95894261 missense probably damaging 1.00
R4654:Aph1a UTSW 3 95895776 missense probably benign 0.01
R4989:Aph1a UTSW 3 95895531 missense probably damaging 1.00
R5134:Aph1a UTSW 3 95895531 missense probably damaging 1.00
R5184:Aph1a UTSW 3 95895739 unclassified probably null
R6603:Aph1a UTSW 3 95895496 missense probably damaging 1.00
R6650:Aph1a UTSW 3 95896286 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CATACTTGACTTCCAAGGAGAGGCG -3'
(R):5'- TCAGAAGGTGACTCCCAACTACCAG -3'

Sequencing Primer
(F):5'- CCAAGGAGAGGCGGTCTG -3'
(R):5'- TGCTGTCAGAAAGGCTGC -3'
Posted On2014-05-23