Incidental Mutation 'R1735:N4bp2'
ID199628
Institutional Source Beutler Lab
Gene Symbol N4bp2
Ensembl Gene ENSMUSG00000037795
Gene NameNEDD4 binding protein 2
SynonymsB3bp, LOC333789, LOC386488
MMRRC Submission 039767-MU
Accession Numbers

Genbank: NM_001024917.1; Ensembl: ENSMUST00000113738

Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R1735 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location65763521-65830108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65808316 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1236 (F1236S)
Ref Sequence ENSEMBL: ENSMUSP00000144278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087264] [ENSMUST00000201489] [ENSMUST00000201615]
Predicted Effect probably damaging
Transcript: ENSMUST00000087264
AA Change: F1236S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084519
Gene: ENSMUSG00000037795
AA Change: F1236S

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.1e-15 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113738
AA Change: F1236S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109367
Gene: ENSMUSG00000037795
AA Change: F1236S

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200843
Predicted Effect probably damaging
Transcript: ENSMUST00000201489
AA Change: F1236S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143807
Gene: ENSMUSG00000037795
AA Change: F1236S

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201615
AA Change: F1236S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144278
Gene: ENSMUSG00000037795
AA Change: F1236S

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.2e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 8e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202411
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.0%
  • 10x: 95.3%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A C 9: 8,027,265 S91A probably benign Het
Acot5 A T 12: 84,075,487 I282F probably benign Het
Adam19 C A 11: 46,138,917 Q730K probably benign Het
Adgrv1 A G 13: 81,487,947 V3481A possibly damaging Het
Akr1c20 T C 13: 4,487,208 D316G probably benign Het
Ap3b1 G A 13: 94,493,717 V827I unknown Het
Aph1a T A 3: 95,895,509 D140E probably damaging Het
Arhgef19 G T 4: 141,249,618 V502L possibly damaging Het
Arl9 T C 5: 77,006,626 F67S probably damaging Het
B430305J03Rik G A 3: 61,363,940 probably benign Het
B4galnt2 A G 11: 95,890,983 F119L probably damaging Het
Bcap29 T A 12: 31,630,840 N49I probably damaging Het
C77080 G T 4: 129,223,577 S476R probably damaging Het
Capn11 T A 17: 45,632,401 K616* probably null Het
Cdh12 T A 15: 21,520,366 Y306N probably damaging Het
Cep350 T A 1: 155,953,214 N315Y probably damaging Het
Cited2 C A 10: 17,724,046 P34Q probably damaging Het
Cmya5 A T 13: 93,089,789 D2930E probably benign Het
Cog3 T A 14: 75,729,321 K470* probably null Het
Commd10 A G 18: 46,990,485 T136A probably benign Het
Csf2ra C A 19: 61,226,344 D181Y probably damaging Het
Csmd1 T A 8: 15,932,610 I2686F probably damaging Het
Dhx29 T C 13: 112,945,086 S415P probably benign Het
Dsel A T 1: 111,860,915 F630Y probably damaging Het
Ell T A 8: 70,578,940 I96N possibly damaging Het
Ephx2 T A 14: 66,088,303 I358L probably benign Het
Fam162b A G 10: 51,587,211 I120T probably damaging Het
Fam187a T C 11: 102,885,780 Y137H probably damaging Het
Fastk T C 5: 24,441,803 E403G probably damaging Het
Fcrlb C A 1: 170,907,332 V409F probably benign Het
Flot2 G T 11: 78,058,005 A269S probably benign Het
Gpd2 T A 2: 57,355,551 N419K probably damaging Het
Hecw1 A T 13: 14,377,765 M61K probably null Het
Htr2a T C 14: 74,706,128 F383L probably damaging Het
Kctd6 C T 14: 8,222,253 R32C probably damaging Het
Khdc1a A G 1: 21,350,965 T125A probably benign Het
Klhl40 T C 9: 121,779,938 S390P probably benign Het
Lonp1 G A 17: 56,614,956 T808I probably damaging Het
Loxhd1 A C 18: 77,404,889 D1342A probably damaging Het
Lrat T C 3: 82,897,110 I187V probably benign Het
Lrif1 T C 3: 106,735,846 *238Q probably null Het
Lrp2bp T C 8: 46,011,988 F48S probably benign Het
Mafg A G 11: 120,629,678 M32T possibly damaging Het
Map4 C T 9: 110,034,955 T416I probably benign Het
Nfatc3 A G 8: 106,083,834 D414G probably damaging Het
Nrip2 T G 6: 128,405,074 V50G probably damaging Het
Olfr1449 T A 19: 12,934,843 I35N probably damaging Het
Olfr16 A G 1: 172,956,807 N4S probably benign Het
Olfr432 A T 1: 174,050,799 K142I probably benign Het
Olfr608 T A 7: 103,470,146 F36I possibly damaging Het
Pcdhb18 A T 18: 37,490,769 H384L probably benign Het
Pik3r1 A T 13: 101,686,374 Y607N probably damaging Het
Plagl2 G A 2: 153,232,477 T168I probably damaging Het
Polr2a A G 11: 69,742,396 S912P probably damaging Het
Ppp1r16b A G 2: 158,761,495 K447E possibly damaging Het
Prkd1 T C 12: 50,342,039 E907G possibly damaging Het
Rabep2 A G 7: 126,444,540 R470G probably damaging Het
Rasal2 T C 1: 157,174,160 Y518C probably damaging Het
Rbmxl1 A G 8: 78,506,082 Y211H probably damaging Het
Rdh7 T C 10: 127,884,585 Y306C probably benign Het
Rtn3 T C 19: 7,457,911 I220V probably damaging Het
Scn8a A G 15: 101,015,861 N1045D possibly damaging Het
Scube1 T C 15: 83,607,437 H952R probably damaging Het
Sf3b1 A G 1: 55,000,652 I690T probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint5 A G 4: 113,563,459 I1108T unknown Het
Snip1 A G 4: 125,071,201 D133G probably benign Het
St3gal3 T C 4: 118,014,774 Y77C probably damaging Het
Sytl3 T C 17: 6,715,481 V112A probably benign Het
Tnxb C T 17: 34,717,970 P3718S probably damaging Het
Ttc24 A T 3: 88,073,094 probably null Het
Ubr3 A T 2: 70,009,129 E1529V probably damaging Het
Utrn T A 10: 12,710,138 H965L probably benign Het
Xrn2 T A 2: 147,061,423 L781Q probably damaging Het
Zbtb11 T C 16: 55,990,682 I401T probably benign Het
Zc3h14 C T 12: 98,758,580 P167L probably damaging Het
Zfp609 G T 9: 65,703,092 S863* probably null Het
Other mutations in N4bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:N4bp2 APN 5 65807524 missense probably damaging 0.96
IGL01503:N4bp2 APN 5 65803547 nonsense probably null 0.00
IGL01621:N4bp2 APN 5 65790924 missense probably damaging 1.00
IGL02109:N4bp2 APN 5 65798134 missense probably damaging 1.00
IGL02286:N4bp2 APN 5 65803552 missense probably damaging 1.00
1mM(1):N4bp2 UTSW 5 65807677 missense probably damaging 1.00
IGL03046:N4bp2 UTSW 5 65790960 missense probably damaging 1.00
R0164:N4bp2 UTSW 5 65803573 splice site probably benign
R0285:N4bp2 UTSW 5 65806559 missense probably benign 0.00
R0366:N4bp2 UTSW 5 65806396 missense possibly damaging 0.95
R0548:N4bp2 UTSW 5 65808153 missense probably benign 0.39
R0551:N4bp2 UTSW 5 65820341 unclassified probably null
R0671:N4bp2 UTSW 5 65807437 missense probably damaging 0.99
R1136:N4bp2 UTSW 5 65808472 missense probably damaging 1.00
R1515:N4bp2 UTSW 5 65790498 missense probably benign 0.01
R1597:N4bp2 UTSW 5 65807140 missense probably benign 0.45
R1628:N4bp2 UTSW 5 65803572 splice site probably null
R1722:N4bp2 UTSW 5 65806882 missense probably benign 0.08
R1745:N4bp2 UTSW 5 65790822 missense probably benign 0.12
R1759:N4bp2 UTSW 5 65826613 missense probably damaging 1.00
R1799:N4bp2 UTSW 5 65806825 missense possibly damaging 0.62
R1846:N4bp2 UTSW 5 65808519 missense probably damaging 1.00
R1872:N4bp2 UTSW 5 65794518 splice site probably benign
R2042:N4bp2 UTSW 5 65826621 missense probably damaging 1.00
R2082:N4bp2 UTSW 5 65807565 missense probably damaging 1.00
R2101:N4bp2 UTSW 5 65790881 missense probably damaging 1.00
R2147:N4bp2 UTSW 5 65809200 missense probably damaging 1.00
R2251:N4bp2 UTSW 5 65806728 missense probably damaging 1.00
R2507:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2508:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2919:N4bp2 UTSW 5 65807098 missense probably benign 0.22
R3086:N4bp2 UTSW 5 65791053 missense probably damaging 1.00
R4092:N4bp2 UTSW 5 65790456 missense probably benign 0.02
R4177:N4bp2 UTSW 5 65798170 splice site probably null
R4718:N4bp2 UTSW 5 65803463 missense probably damaging 1.00
R4859:N4bp2 UTSW 5 65825298 missense probably damaging 1.00
R4863:N4bp2 UTSW 5 65808130 missense probably benign 0.22
R4915:N4bp2 UTSW 5 65803504 missense probably damaging 1.00
R4949:N4bp2 UTSW 5 65821799 splice site probably null
R4978:N4bp2 UTSW 5 65790240 missense probably damaging 1.00
R5029:N4bp2 UTSW 5 65814780 missense probably damaging 1.00
R5079:N4bp2 UTSW 5 65811977 missense probably damaging 1.00
R5097:N4bp2 UTSW 5 65817218 missense probably damaging 1.00
R5158:N4bp2 UTSW 5 65808462 missense probably damaging 0.99
R5228:N4bp2 UTSW 5 65807518 missense probably benign
R5322:N4bp2 UTSW 5 65790457 missense possibly damaging 0.76
R5554:N4bp2 UTSW 5 65808114 missense probably benign 0.44
R5731:N4bp2 UTSW 5 65809157 missense probably damaging 1.00
R5840:N4bp2 UTSW 5 65808094 missense probably damaging 0.99
R6393:N4bp2 UTSW 5 65791001 missense possibly damaging 0.81
R6767:N4bp2 UTSW 5 65817187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAATGCTGCTGTAAAGGTCAAG -3'
(R):5'- AGCTCCAGACAGTCTATGGTCAGAG -3'

Sequencing Primer
(F):5'- GCGCGTACACCTTTAAGCAG -3'
(R):5'- ACAGTCTATGGTCAGAGATGTG -3'
Posted On2014-05-23