Incidental Mutation 'R1735:Pik3r1'
ID199668
Institutional Source Beutler Lab
Gene Symbol Pik3r1
Ensembl Gene ENSMUSG00000041417
Gene Namephosphoinositide-3-kinase regulatory subunit 1
Synonymsp55alpha, p85alpha, PI3K, p50alpha
MMRRC Submission 039767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1735 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location101680563-101768217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101686374 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 607 (Y607N)
Ref Sequence ENSEMBL: ENSMUSP00000056774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035532] [ENSMUST00000055518] [ENSMUST00000185795] [ENSMUST00000187009]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035532
AA Change: Y337N

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047004
Gene: ENSMUSG00000041417
AA Change: Y337N

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
SH2 61 144 9.96e-28 SMART
low complexity region 263 278 N/A INTRINSIC
SH2 352 434 7.33e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000055518
AA Change: Y607N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056774
Gene: ENSMUSG00000041417
AA Change: Y607N

DomainStartEndE-ValueType
SH3 6 78 2.81e-11 SMART
low complexity region 79 99 N/A INTRINSIC
RhoGAP 126 298 1.94e-37 SMART
low complexity region 303 314 N/A INTRINSIC
SH2 331 414 9.96e-28 SMART
Pfam:PI3K_P85_iSH2 431 599 7.8e-67 PFAM
SH2 622 704 7.33e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185795
SMART Domains Protein: ENSMUSP00000140312
Gene: ENSMUSG00000041417

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
SH2 31 112 1.52e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187009
SMART Domains Protein: ENSMUSP00000140256
Gene: ENSMUSG00000041417

DomainStartEndE-ValueType
SH2 10 93 6.5e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190171
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.0%
  • 10x: 95.3%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit perinatal lethality associated with hepatic necrosis, chylous ascites, enlarged muscle fibers, calcification of cardiac tissue, and hypoglycemia. Mutants lacking only the major isoform are immunodeficient. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A C 9: 8,027,265 S91A probably benign Het
Acot5 A T 12: 84,075,487 I282F probably benign Het
Adam19 C A 11: 46,138,917 Q730K probably benign Het
Adgrv1 A G 13: 81,487,947 V3481A possibly damaging Het
Akr1c20 T C 13: 4,487,208 D316G probably benign Het
Ap3b1 G A 13: 94,493,717 V827I unknown Het
Aph1a T A 3: 95,895,509 D140E probably damaging Het
Arhgef19 G T 4: 141,249,618 V502L possibly damaging Het
Arl9 T C 5: 77,006,626 F67S probably damaging Het
B430305J03Rik G A 3: 61,363,940 probably benign Het
B4galnt2 A G 11: 95,890,983 F119L probably damaging Het
Bcap29 T A 12: 31,630,840 N49I probably damaging Het
C77080 G T 4: 129,223,577 S476R probably damaging Het
Capn11 T A 17: 45,632,401 K616* probably null Het
Cdh12 T A 15: 21,520,366 Y306N probably damaging Het
Cep350 T A 1: 155,953,214 N315Y probably damaging Het
Cited2 C A 10: 17,724,046 P34Q probably damaging Het
Cmya5 A T 13: 93,089,789 D2930E probably benign Het
Cog3 T A 14: 75,729,321 K470* probably null Het
Commd10 A G 18: 46,990,485 T136A probably benign Het
Csf2ra C A 19: 61,226,344 D181Y probably damaging Het
Csmd1 T A 8: 15,932,610 I2686F probably damaging Het
Dhx29 T C 13: 112,945,086 S415P probably benign Het
Dsel A T 1: 111,860,915 F630Y probably damaging Het
Ell T A 8: 70,578,940 I96N possibly damaging Het
Ephx2 T A 14: 66,088,303 I358L probably benign Het
Fam162b A G 10: 51,587,211 I120T probably damaging Het
Fam187a T C 11: 102,885,780 Y137H probably damaging Het
Fastk T C 5: 24,441,803 E403G probably damaging Het
Fcrlb C A 1: 170,907,332 V409F probably benign Het
Flot2 G T 11: 78,058,005 A269S probably benign Het
Gpd2 T A 2: 57,355,551 N419K probably damaging Het
Hecw1 A T 13: 14,377,765 M61K probably null Het
Htr2a T C 14: 74,706,128 F383L probably damaging Het
Kctd6 C T 14: 8,222,253 R32C probably damaging Het
Khdc1a A G 1: 21,350,965 T125A probably benign Het
Klhl40 T C 9: 121,779,938 S390P probably benign Het
Lonp1 G A 17: 56,614,956 T808I probably damaging Het
Loxhd1 A C 18: 77,404,889 D1342A probably damaging Het
Lrat T C 3: 82,897,110 I187V probably benign Het
Lrif1 T C 3: 106,735,846 *238Q probably null Het
Lrp2bp T C 8: 46,011,988 F48S probably benign Het
Mafg A G 11: 120,629,678 M32T possibly damaging Het
Map4 C T 9: 110,034,955 T416I probably benign Het
N4bp2 T C 5: 65,808,316 F1236S probably damaging Het
Nfatc3 A G 8: 106,083,834 D414G probably damaging Het
Nrip2 T G 6: 128,405,074 V50G probably damaging Het
Olfr1449 T A 19: 12,934,843 I35N probably damaging Het
Olfr16 A G 1: 172,956,807 N4S probably benign Het
Olfr432 A T 1: 174,050,799 K142I probably benign Het
Olfr608 T A 7: 103,470,146 F36I possibly damaging Het
Pcdhb18 A T 18: 37,490,769 H384L probably benign Het
Plagl2 G A 2: 153,232,477 T168I probably damaging Het
Polr2a A G 11: 69,742,396 S912P probably damaging Het
Ppp1r16b A G 2: 158,761,495 K447E possibly damaging Het
Prkd1 T C 12: 50,342,039 E907G possibly damaging Het
Rabep2 A G 7: 126,444,540 R470G probably damaging Het
Rasal2 T C 1: 157,174,160 Y518C probably damaging Het
Rbmxl1 A G 8: 78,506,082 Y211H probably damaging Het
Rdh7 T C 10: 127,884,585 Y306C probably benign Het
Rtn3 T C 19: 7,457,911 I220V probably damaging Het
Scn8a A G 15: 101,015,861 N1045D possibly damaging Het
Scube1 T C 15: 83,607,437 H952R probably damaging Het
Sf3b1 A G 1: 55,000,652 I690T probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint5 A G 4: 113,563,459 I1108T unknown Het
Snip1 A G 4: 125,071,201 D133G probably benign Het
St3gal3 T C 4: 118,014,774 Y77C probably damaging Het
Sytl3 T C 17: 6,715,481 V112A probably benign Het
Tnxb C T 17: 34,717,970 P3718S probably damaging Het
Ttc24 A T 3: 88,073,094 probably null Het
Ubr3 A T 2: 70,009,129 E1529V probably damaging Het
Utrn T A 10: 12,710,138 H965L probably benign Het
Xrn2 T A 2: 147,061,423 L781Q probably damaging Het
Zbtb11 T C 16: 55,990,682 I401T probably benign Het
Zc3h14 C T 12: 98,758,580 P167L probably damaging Het
Zfp609 G T 9: 65,703,092 S863* probably null Het
Other mutations in Pik3r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pik3r1 APN 13 101690536 start codon destroyed probably benign
IGL00484:Pik3r1 APN 13 101701747 missense probably benign 0.08
IGL00911:Pik3r1 APN 13 101757661 utr 5 prime probably benign
IGL01620:Pik3r1 APN 13 101686220 missense probably damaging 1.00
IGL01872:Pik3r1 APN 13 101689117 missense probably benign 0.01
IGL02544:Pik3r1 APN 13 101687276 missense probably damaging 1.00
IGL02959:Pik3r1 APN 13 101757529 missense probably benign 0.02
anubis UTSW 13 101702776 nonsense probably null
astro_boy UTSW 13 101701732 missense probably damaging 1.00
Rocket UTSW 13 101689444 missense probably damaging 1.00
R0635:Pik3r1 UTSW 13 101757418 missense probably benign
R0751:Pik3r1 UTSW 13 101686358 unclassified probably null
R0787:Pik3r1 UTSW 13 101690523 missense probably benign 0.30
R0845:Pik3r1 UTSW 13 101686264 missense probably benign 0.45
R0891:Pik3r1 UTSW 13 101701466 missense probably benign
R1066:Pik3r1 UTSW 13 101688663 missense probably damaging 1.00
R1184:Pik3r1 UTSW 13 101686358 unclassified probably null
R2474:Pik3r1 UTSW 13 101702776 nonsense probably null
R3015:Pik3r1 UTSW 13 101687263 missense probably damaging 1.00
R3419:Pik3r1 UTSW 13 101692215 missense probably benign 0.17
R3876:Pik3r1 UTSW 13 101684957 missense probably benign 0.01
R3964:Pik3r1 UTSW 13 101688685 missense possibly damaging 0.75
R4175:Pik3r1 UTSW 13 101701732 missense probably damaging 1.00
R4175:Pik3r1 UTSW 13 101701733 missense probably benign 0.25
R4422:Pik3r1 UTSW 13 101694384 missense probably benign
R4890:Pik3r1 UTSW 13 101757610 missense probably damaging 1.00
R5038:Pik3r1 UTSW 13 101689444 missense probably damaging 1.00
R5117:Pik3r1 UTSW 13 101692236 missense probably benign
R6066:Pik3r1 UTSW 13 101686320 missense possibly damaging 0.72
R6254:Pik3r1 UTSW 13 101689406 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TACACTACGGAGCAGGCATAGCAG -3'
(R):5'- CCGTAATGATGTCCCCGAACATCAG -3'

Sequencing Primer
(F):5'- GCATAGCAGCCCTGCTTAC -3'
(R):5'- acatcaggaaaaaaatccccac -3'
Posted On2014-05-23