Incidental Mutation 'R1735:Cog3'
ID199673
Institutional Source Beutler Lab
Gene Symbol Cog3
Ensembl Gene ENSMUSG00000034893
Gene Namecomponent of oligomeric golgi complex 3
Synonyms
MMRRC Submission 039767-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R1735 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location75702350-75754517 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 75729321 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 470 (K470*)
Ref Sequence ENSEMBL: ENSMUSP00000154131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049168] [ENSMUST00000227473]
Predicted Effect probably null
Transcript: ENSMUST00000049168
AA Change: K480*
SMART Domains Protein: ENSMUSP00000045016
Gene: ENSMUSG00000034893
AA Change: K480*

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Sec34 130 277 9.5e-57 PFAM
Blast:HisKA 745 810 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226686
Predicted Effect probably null
Transcript: ENSMUST00000227473
AA Change: K470*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228081
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.0%
  • 10x: 95.3%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the conserved oligomeric Golgi (COG) complex which is composed of eight different subunits and is required for normal Golgi morphology and localization. Defects in the COG complex result in multiple deficiencies in protein glycosylation. The protein encoded by this gene is involved in ER-Golgi transport.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A C 9: 8,027,265 S91A probably benign Het
Acot5 A T 12: 84,075,487 I282F probably benign Het
Adam19 C A 11: 46,138,917 Q730K probably benign Het
Adgrv1 A G 13: 81,487,947 V3481A possibly damaging Het
Akr1c20 T C 13: 4,487,208 D316G probably benign Het
Ap3b1 G A 13: 94,493,717 V827I unknown Het
Aph1a T A 3: 95,895,509 D140E probably damaging Het
Arhgef19 G T 4: 141,249,618 V502L possibly damaging Het
Arl9 T C 5: 77,006,626 F67S probably damaging Het
B430305J03Rik G A 3: 61,363,940 probably benign Het
B4galnt2 A G 11: 95,890,983 F119L probably damaging Het
Bcap29 T A 12: 31,630,840 N49I probably damaging Het
C77080 G T 4: 129,223,577 S476R probably damaging Het
Capn11 T A 17: 45,632,401 K616* probably null Het
Cdh12 T A 15: 21,520,366 Y306N probably damaging Het
Cep350 T A 1: 155,953,214 N315Y probably damaging Het
Cited2 C A 10: 17,724,046 P34Q probably damaging Het
Cmya5 A T 13: 93,089,789 D2930E probably benign Het
Commd10 A G 18: 46,990,485 T136A probably benign Het
Csf2ra C A 19: 61,226,344 D181Y probably damaging Het
Csmd1 T A 8: 15,932,610 I2686F probably damaging Het
Dhx29 T C 13: 112,945,086 S415P probably benign Het
Dsel A T 1: 111,860,915 F630Y probably damaging Het
Ell T A 8: 70,578,940 I96N possibly damaging Het
Ephx2 T A 14: 66,088,303 I358L probably benign Het
Fam162b A G 10: 51,587,211 I120T probably damaging Het
Fam187a T C 11: 102,885,780 Y137H probably damaging Het
Fastk T C 5: 24,441,803 E403G probably damaging Het
Fcrlb C A 1: 170,907,332 V409F probably benign Het
Flot2 G T 11: 78,058,005 A269S probably benign Het
Gpd2 T A 2: 57,355,551 N419K probably damaging Het
Hecw1 A T 13: 14,377,765 M61K probably null Het
Htr2a T C 14: 74,706,128 F383L probably damaging Het
Kctd6 C T 14: 8,222,253 R32C probably damaging Het
Khdc1a A G 1: 21,350,965 T125A probably benign Het
Klhl40 T C 9: 121,779,938 S390P probably benign Het
Lonp1 G A 17: 56,614,956 T808I probably damaging Het
Loxhd1 A C 18: 77,404,889 D1342A probably damaging Het
Lrat T C 3: 82,897,110 I187V probably benign Het
Lrif1 T C 3: 106,735,846 *238Q probably null Het
Lrp2bp T C 8: 46,011,988 F48S probably benign Het
Mafg A G 11: 120,629,678 M32T possibly damaging Het
Map4 C T 9: 110,034,955 T416I probably benign Het
N4bp2 T C 5: 65,808,316 F1236S probably damaging Het
Nfatc3 A G 8: 106,083,834 D414G probably damaging Het
Nrip2 T G 6: 128,405,074 V50G probably damaging Het
Olfr1449 T A 19: 12,934,843 I35N probably damaging Het
Olfr16 A G 1: 172,956,807 N4S probably benign Het
Olfr432 A T 1: 174,050,799 K142I probably benign Het
Olfr608 T A 7: 103,470,146 F36I possibly damaging Het
Pcdhb18 A T 18: 37,490,769 H384L probably benign Het
Pik3r1 A T 13: 101,686,374 Y607N probably damaging Het
Plagl2 G A 2: 153,232,477 T168I probably damaging Het
Polr2a A G 11: 69,742,396 S912P probably damaging Het
Ppp1r16b A G 2: 158,761,495 K447E possibly damaging Het
Prkd1 T C 12: 50,342,039 E907G possibly damaging Het
Rabep2 A G 7: 126,444,540 R470G probably damaging Het
Rasal2 T C 1: 157,174,160 Y518C probably damaging Het
Rbmxl1 A G 8: 78,506,082 Y211H probably damaging Het
Rdh7 T C 10: 127,884,585 Y306C probably benign Het
Rtn3 T C 19: 7,457,911 I220V probably damaging Het
Scn8a A G 15: 101,015,861 N1045D possibly damaging Het
Scube1 T C 15: 83,607,437 H952R probably damaging Het
Sf3b1 A G 1: 55,000,652 I690T probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint5 A G 4: 113,563,459 I1108T unknown Het
Snip1 A G 4: 125,071,201 D133G probably benign Het
St3gal3 T C 4: 118,014,774 Y77C probably damaging Het
Sytl3 T C 17: 6,715,481 V112A probably benign Het
Tnxb C T 17: 34,717,970 P3718S probably damaging Het
Ttc24 A T 3: 88,073,094 probably null Het
Ubr3 A T 2: 70,009,129 E1529V probably damaging Het
Utrn T A 10: 12,710,138 H965L probably benign Het
Xrn2 T A 2: 147,061,423 L781Q probably damaging Het
Zbtb11 T C 16: 55,990,682 I401T probably benign Het
Zc3h14 C T 12: 98,758,580 P167L probably damaging Het
Zfp609 G T 9: 65,703,092 S863* probably null Het
Other mutations in Cog3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Cog3 APN 14 75730604 missense possibly damaging 0.79
IGL02637:Cog3 APN 14 75722196 splice site probably benign
IGL02934:Cog3 APN 14 75741689 missense probably damaging 0.99
R0105:Cog3 UTSW 14 75722140 missense probably damaging 0.99
R0105:Cog3 UTSW 14 75722140 missense probably damaging 0.99
R0403:Cog3 UTSW 14 75742327 splice site probably benign
R0972:Cog3 UTSW 14 75717170 missense probably benign
R1813:Cog3 UTSW 14 75742344 missense probably benign 0.03
R1896:Cog3 UTSW 14 75742344 missense probably benign 0.03
R2517:Cog3 UTSW 14 75741742 missense probably benign 0.01
R2567:Cog3 UTSW 14 75754290 missense probably benign
R2962:Cog3 UTSW 14 75740534 critical splice donor site probably null
R3103:Cog3 UTSW 14 75747201 critical splice acceptor site probably null
R3689:Cog3 UTSW 14 75754438 start codon destroyed probably null
R3691:Cog3 UTSW 14 75754438 start codon destroyed probably null
R3927:Cog3 UTSW 14 75743558 splice site probably benign
R4581:Cog3 UTSW 14 75732951 missense probably benign 0.04
R4932:Cog3 UTSW 14 75732954 missense probably damaging 0.98
R5560:Cog3 UTSW 14 75729393 missense probably damaging 1.00
R5654:Cog3 UTSW 14 75724799 missense probably benign 0.03
R6253:Cog3 UTSW 14 75719712 missense probably damaging 1.00
R6419:Cog3 UTSW 14 75724738 nonsense probably null
R6791:Cog3 UTSW 14 75730678 missense probably damaging 1.00
R6803:Cog3 UTSW 14 75704039 missense probably benign 0.00
X0017:Cog3 UTSW 14 75741741 missense probably benign 0.01
X0021:Cog3 UTSW 14 75743593 missense possibly damaging 0.87
X0066:Cog3 UTSW 14 75741741 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAGCCGCTTACATGCCATTC -3'
(R):5'- GGTCCATGCTATGTCAGTAATCTCTGC -3'

Sequencing Primer
(F):5'- TAGGGATGCACATGTCCTGAC -3'
(R):5'- CTCTGCTTAGTTAAAAGGCAGC -3'
Posted On2014-05-23