Incidental Mutation 'R1735:Cdh12'
ID199675
Institutional Source Beutler Lab
Gene Symbol Cdh12
Ensembl Gene ENSMUSG00000040452
Gene Namecadherin 12
SynonymsBr-cadherin
MMRRC Submission 039767-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R1735 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location20449265-21589533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21520366 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 306 (Y306N)
Ref Sequence ENSEMBL: ENSMUSP00000153750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075132] [ENSMUST00000227496]
Predicted Effect probably damaging
Transcript: ENSMUST00000075132
AA Change: Y306N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074632
Gene: ENSMUSG00000040452
AA Change: Y306N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 77 158 5.18e-18 SMART
CA 182 267 4.4e-30 SMART
CA 291 383 2.42e-18 SMART
CA 406 487 7.55e-20 SMART
CA 510 597 9.3e-2 SMART
transmembrane domain 615 637 N/A INTRINSIC
Pfam:Cadherin_C 640 784 1.7e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227496
AA Change: Y306N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.0%
  • 10x: 95.3%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in both the excitatory and inhibitory neurons in various areas of the adult central nervous system including the cerebellum, neocortex, hippocampus and in different subcortical nuclei. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A C 9: 8,027,265 S91A probably benign Het
Acot5 A T 12: 84,075,487 I282F probably benign Het
Adam19 C A 11: 46,138,917 Q730K probably benign Het
Adgrv1 A G 13: 81,487,947 V3481A possibly damaging Het
Akr1c20 T C 13: 4,487,208 D316G probably benign Het
Ap3b1 G A 13: 94,493,717 V827I unknown Het
Aph1a T A 3: 95,895,509 D140E probably damaging Het
Arhgef19 G T 4: 141,249,618 V502L possibly damaging Het
Arl9 T C 5: 77,006,626 F67S probably damaging Het
B430305J03Rik G A 3: 61,363,940 probably benign Het
B4galnt2 A G 11: 95,890,983 F119L probably damaging Het
Bcap29 T A 12: 31,630,840 N49I probably damaging Het
C77080 G T 4: 129,223,577 S476R probably damaging Het
Capn11 T A 17: 45,632,401 K616* probably null Het
Cep350 T A 1: 155,953,214 N315Y probably damaging Het
Cited2 C A 10: 17,724,046 P34Q probably damaging Het
Cmya5 A T 13: 93,089,789 D2930E probably benign Het
Cog3 T A 14: 75,729,321 K470* probably null Het
Commd10 A G 18: 46,990,485 T136A probably benign Het
Csf2ra C A 19: 61,226,344 D181Y probably damaging Het
Csmd1 T A 8: 15,932,610 I2686F probably damaging Het
Dhx29 T C 13: 112,945,086 S415P probably benign Het
Dsel A T 1: 111,860,915 F630Y probably damaging Het
Ell T A 8: 70,578,940 I96N possibly damaging Het
Ephx2 T A 14: 66,088,303 I358L probably benign Het
Fam162b A G 10: 51,587,211 I120T probably damaging Het
Fam187a T C 11: 102,885,780 Y137H probably damaging Het
Fastk T C 5: 24,441,803 E403G probably damaging Het
Fcrlb C A 1: 170,907,332 V409F probably benign Het
Flot2 G T 11: 78,058,005 A269S probably benign Het
Gpd2 T A 2: 57,355,551 N419K probably damaging Het
Hecw1 A T 13: 14,377,765 M61K probably null Het
Htr2a T C 14: 74,706,128 F383L probably damaging Het
Kctd6 C T 14: 8,222,253 R32C probably damaging Het
Khdc1a A G 1: 21,350,965 T125A probably benign Het
Klhl40 T C 9: 121,779,938 S390P probably benign Het
Lonp1 G A 17: 56,614,956 T808I probably damaging Het
Loxhd1 A C 18: 77,404,889 D1342A probably damaging Het
Lrat T C 3: 82,897,110 I187V probably benign Het
Lrif1 T C 3: 106,735,846 *238Q probably null Het
Lrp2bp T C 8: 46,011,988 F48S probably benign Het
Mafg A G 11: 120,629,678 M32T possibly damaging Het
Map4 C T 9: 110,034,955 T416I probably benign Het
N4bp2 T C 5: 65,808,316 F1236S probably damaging Het
Nfatc3 A G 8: 106,083,834 D414G probably damaging Het
Nrip2 T G 6: 128,405,074 V50G probably damaging Het
Olfr1449 T A 19: 12,934,843 I35N probably damaging Het
Olfr16 A G 1: 172,956,807 N4S probably benign Het
Olfr432 A T 1: 174,050,799 K142I probably benign Het
Olfr608 T A 7: 103,470,146 F36I possibly damaging Het
Pcdhb18 A T 18: 37,490,769 H384L probably benign Het
Pik3r1 A T 13: 101,686,374 Y607N probably damaging Het
Plagl2 G A 2: 153,232,477 T168I probably damaging Het
Polr2a A G 11: 69,742,396 S912P probably damaging Het
Ppp1r16b A G 2: 158,761,495 K447E possibly damaging Het
Prkd1 T C 12: 50,342,039 E907G possibly damaging Het
Rabep2 A G 7: 126,444,540 R470G probably damaging Het
Rasal2 T C 1: 157,174,160 Y518C probably damaging Het
Rbmxl1 A G 8: 78,506,082 Y211H probably damaging Het
Rdh7 T C 10: 127,884,585 Y306C probably benign Het
Rtn3 T C 19: 7,457,911 I220V probably damaging Het
Scn8a A G 15: 101,015,861 N1045D possibly damaging Het
Scube1 T C 15: 83,607,437 H952R probably damaging Het
Sf3b1 A G 1: 55,000,652 I690T probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint5 A G 4: 113,563,459 I1108T unknown Het
Snip1 A G 4: 125,071,201 D133G probably benign Het
St3gal3 T C 4: 118,014,774 Y77C probably damaging Het
Sytl3 T C 17: 6,715,481 V112A probably benign Het
Tnxb C T 17: 34,717,970 P3718S probably damaging Het
Ttc24 A T 3: 88,073,094 probably null Het
Ubr3 A T 2: 70,009,129 E1529V probably damaging Het
Utrn T A 10: 12,710,138 H965L probably benign Het
Xrn2 T A 2: 147,061,423 L781Q probably damaging Het
Zbtb11 T C 16: 55,990,682 I401T probably benign Het
Zc3h14 C T 12: 98,758,580 P167L probably damaging Het
Zfp609 G T 9: 65,703,092 S863* probably null Het
Other mutations in Cdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Cdh12 APN 15 21237903 missense probably damaging 0.98
IGL01414:Cdh12 APN 15 21492689 missense probably damaging 1.00
IGL02088:Cdh12 APN 15 21480339 nonsense probably null
IGL02894:Cdh12 APN 15 21586294 missense probably damaging 1.00
IGL03008:Cdh12 APN 15 21480330 missense probably damaging 0.98
IGL03271:Cdh12 APN 15 21586453 missense probably benign 0.19
IGL03402:Cdh12 APN 15 21583740 missense probably benign 0.08
R0042:Cdh12 UTSW 15 21537677 splice site probably benign
R0126:Cdh12 UTSW 15 21583945 missense probably benign
R0239:Cdh12 UTSW 15 21586407 missense probably damaging 1.00
R0239:Cdh12 UTSW 15 21586407 missense probably damaging 1.00
R0335:Cdh12 UTSW 15 21578549 critical splice donor site probably null
R0421:Cdh12 UTSW 15 21480224 critical splice acceptor site probably null
R0918:Cdh12 UTSW 15 21492599 missense probably damaging 0.99
R0972:Cdh12 UTSW 15 21237764 missense probably benign 0.27
R1014:Cdh12 UTSW 15 21492620 missense probably damaging 0.97
R1304:Cdh12 UTSW 15 21583937 missense probably benign 0.10
R1677:Cdh12 UTSW 15 21520405 missense probably damaging 0.99
R1916:Cdh12 UTSW 15 21520250 splice site probably null
R1950:Cdh12 UTSW 15 21237879 missense probably damaging 1.00
R2059:Cdh12 UTSW 15 21583740 missense probably benign 0.08
R2157:Cdh12 UTSW 15 21583787 missense possibly damaging 0.84
R2404:Cdh12 UTSW 15 21537634 missense probably damaging 1.00
R3625:Cdh12 UTSW 15 21358756 missense probably damaging 1.00
R3703:Cdh12 UTSW 15 21583826 missense probably damaging 0.97
R3704:Cdh12 UTSW 15 21583826 missense probably damaging 0.97
R3743:Cdh12 UTSW 15 21537659 missense probably damaging 0.98
R3771:Cdh12 UTSW 15 21578554 splice site probably benign
R3780:Cdh12 UTSW 15 21585977 splice site probably null
R4750:Cdh12 UTSW 15 21583808 missense possibly damaging 0.59
R5373:Cdh12 UTSW 15 21583912 missense probably damaging 1.00
R5374:Cdh12 UTSW 15 21583912 missense probably damaging 1.00
R5443:Cdh12 UTSW 15 21237849 missense probably benign 0.01
R5548:Cdh12 UTSW 15 21492654 missense probably damaging 1.00
R5746:Cdh12 UTSW 15 21358724 missense probably null 1.00
R5960:Cdh12 UTSW 15 21492476 intron probably null
R6248:Cdh12 UTSW 15 21237714 missense possibly damaging 0.82
R6379:Cdh12 UTSW 15 21492657 missense probably benign 0.02
R6419:Cdh12 UTSW 15 21520397 missense probably damaging 0.99
R6560:Cdh12 UTSW 15 21492594 missense probably damaging 1.00
R6901:Cdh12 UTSW 15 21583786 missense probably benign 0.01
X0065:Cdh12 UTSW 15 21358765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCAGCTAAAGTTCTACATCAGGA -3'
(R):5'- AGATGTCATTTGGCAAACTAAGAAGCCT -3'

Sequencing Primer
(F):5'- TCTACATCAGGACATTCTGAAGGG -3'
(R):5'- TCTTGTGTATCCTCATCTGTGAC -3'
Posted On2014-05-23