Incidental Mutation 'R1735:Scn8a'
ID199678
Institutional Source Beutler Lab
Gene Symbol Scn8a
Ensembl Gene ENSMUSG00000023033
Gene Namesodium channel, voltage-gated, type VIII, alpha
Synonymsmnd2, C630029C19Rik, nmf58, NMF335, mnd-2, seal, motor end-plate disease, nur14, Nav1.6, med, ataxia 3, nmf2, nmf335, NaCh6
MMRRC Submission 039767-MU
Accession Numbers

Genbank: NM_001077499, NM_011323; MGI: 103169

Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R1735 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location100869858-101045938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101015861 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1045 (N1045D)
Ref Sequence ENSEMBL: ENSMUSP00000144371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082209] [ENSMUST00000108908] [ENSMUST00000108909] [ENSMUST00000108910] [ENSMUST00000200963] [ENSMUST00000201518] [ENSMUST00000201549]
Predicted Effect probably benign
Transcript: ENSMUST00000082209
AA Change: N1045D

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080842
Gene: ENSMUSG00000023033
AA Change: N1045D

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108908
AA Change: N1045D

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104536
Gene: ENSMUSG00000023033
AA Change: N1045D

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 1.9e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Pfam:Ion_trans 451 640 1.1e-47 PFAM
Pfam:Na_trans_assoc 655 872 1.9e-71 PFAM
Pfam:Ion_trans 898 1127 4.4e-59 PFAM
PDB:1BYY|A 1129 1181 7e-30 PDB
Pfam:Ion_trans 1220 1429 1.9e-51 PFAM
Pfam:PKD_channel 1281 1436 5.6e-7 PFAM
IQ 1558 1580 1.2e-4 SMART
low complexity region 1619 1638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108909
AA Change: N1055D

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104537
Gene: ENSMUSG00000023033
AA Change: N1055D

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 2.2e-76 PFAM
low complexity region 335 364 N/A INTRINSIC
Pfam:DUF3451 390 616 8.7e-70 PFAM
Pfam:Ion_trans 697 886 1.3e-47 PFAM
Pfam:Na_trans_assoc 901 1118 2.3e-71 PFAM
Pfam:Ion_trans 1144 1186 9.7e-10 PFAM
Pfam:Ion_trans 1182 1332 1.7e-31 PFAM
PDB:1BYY|A 1334 1386 2e-29 PDB
Pfam:Ion_trans 1425 1634 2.3e-51 PFAM
Pfam:PKD_channel 1486 1641 6.6e-7 PFAM
IQ 1763 1785 1.2e-4 SMART
low complexity region 1824 1843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108910
AA Change: N1045D

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104538
Gene: ENSMUSG00000023033
AA Change: N1045D

DomainStartEndE-ValueType
Pfam:Ion_trans 160 410 2.5e-76 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:DUF3451 478 704 9.6e-70 PFAM
Pfam:Ion_trans 785 974 1.4e-47 PFAM
Pfam:Na_trans_assoc 989 1206 2.5e-71 PFAM
Pfam:Ion_trans 1232 1461 5.7e-59 PFAM
PDB:1BYY|A 1463 1515 4e-29 PDB
Pfam:Ion_trans 1554 1763 2.5e-51 PFAM
Pfam:PKD_channel 1615 1770 7.1e-7 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200963
AA Change: N1045D

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144371
Gene: ENSMUSG00000023033
AA Change: N1045D

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 4.1e-80 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 2.5e-69 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 1.2e-55 PFAM
Pfam:Na_trans_assoc 989 1191 9.1e-57 PFAM
Pfam:Ion_trans 1195 1274 7.6e-16 PFAM
Pfam:Ion_trans 1270 1431 2.6e-33 PFAM
Pfam:Ion_trans 1478 1734 6.5e-55 PFAM
IQ 1851 1873 6e-7 SMART
low complexity region 1912 1931 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201246
Predicted Effect probably benign
Transcript: ENSMUST00000201518
SMART Domains Protein: ENSMUSP00000143879
Gene: ENSMUSG00000023033

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 8.8e-81 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 6.7e-70 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 804 5.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201549
AA Change: N1045D

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144013
Gene: ENSMUSG00000023033
AA Change: N1045D

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.0%
  • 10x: 95.3%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
Allele List at MGI

 All alleles(22) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Transgenic(1) Spontaneous(5) Chemically induced(8)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A C 9: 8,027,265 S91A probably benign Het
Acot5 A T 12: 84,075,487 I282F probably benign Het
Adam19 C A 11: 46,138,917 Q730K probably benign Het
Adgrv1 A G 13: 81,487,947 V3481A possibly damaging Het
Akr1c20 T C 13: 4,487,208 D316G probably benign Het
Ap3b1 G A 13: 94,493,717 V827I unknown Het
Aph1a T A 3: 95,895,509 D140E probably damaging Het
Arhgef19 G T 4: 141,249,618 V502L possibly damaging Het
Arl9 T C 5: 77,006,626 F67S probably damaging Het
B430305J03Rik G A 3: 61,363,940 probably benign Het
B4galnt2 A G 11: 95,890,983 F119L probably damaging Het
Bcap29 T A 12: 31,630,840 N49I probably damaging Het
C77080 G T 4: 129,223,577 S476R probably damaging Het
Capn11 T A 17: 45,632,401 K616* probably null Het
Cdh12 T A 15: 21,520,366 Y306N probably damaging Het
Cep350 T A 1: 155,953,214 N315Y probably damaging Het
Cited2 C A 10: 17,724,046 P34Q probably damaging Het
Cmya5 A T 13: 93,089,789 D2930E probably benign Het
Cog3 T A 14: 75,729,321 K470* probably null Het
Commd10 A G 18: 46,990,485 T136A probably benign Het
Csf2ra C A 19: 61,226,344 D181Y probably damaging Het
Csmd1 T A 8: 15,932,610 I2686F probably damaging Het
Dhx29 T C 13: 112,945,086 S415P probably benign Het
Dsel A T 1: 111,860,915 F630Y probably damaging Het
Ell T A 8: 70,578,940 I96N possibly damaging Het
Ephx2 T A 14: 66,088,303 I358L probably benign Het
Fam162b A G 10: 51,587,211 I120T probably damaging Het
Fam187a T C 11: 102,885,780 Y137H probably damaging Het
Fastk T C 5: 24,441,803 E403G probably damaging Het
Fcrlb C A 1: 170,907,332 V409F probably benign Het
Flot2 G T 11: 78,058,005 A269S probably benign Het
Gpd2 T A 2: 57,355,551 N419K probably damaging Het
Hecw1 A T 13: 14,377,765 M61K probably null Het
Htr2a T C 14: 74,706,128 F383L probably damaging Het
Kctd6 C T 14: 8,222,253 R32C probably damaging Het
Khdc1a A G 1: 21,350,965 T125A probably benign Het
Klhl40 T C 9: 121,779,938 S390P probably benign Het
Lonp1 G A 17: 56,614,956 T808I probably damaging Het
Loxhd1 A C 18: 77,404,889 D1342A probably damaging Het
Lrat T C 3: 82,897,110 I187V probably benign Het
Lrif1 T C 3: 106,735,846 *238Q probably null Het
Lrp2bp T C 8: 46,011,988 F48S probably benign Het
Mafg A G 11: 120,629,678 M32T possibly damaging Het
Map4 C T 9: 110,034,955 T416I probably benign Het
N4bp2 T C 5: 65,808,316 F1236S probably damaging Het
Nfatc3 A G 8: 106,083,834 D414G probably damaging Het
Nrip2 T G 6: 128,405,074 V50G probably damaging Het
Olfr1449 T A 19: 12,934,843 I35N probably damaging Het
Olfr16 A G 1: 172,956,807 N4S probably benign Het
Olfr432 A T 1: 174,050,799 K142I probably benign Het
Olfr608 T A 7: 103,470,146 F36I possibly damaging Het
Pcdhb18 A T 18: 37,490,769 H384L probably benign Het
Pik3r1 A T 13: 101,686,374 Y607N probably damaging Het
Plagl2 G A 2: 153,232,477 T168I probably damaging Het
Polr2a A G 11: 69,742,396 S912P probably damaging Het
Ppp1r16b A G 2: 158,761,495 K447E possibly damaging Het
Prkd1 T C 12: 50,342,039 E907G possibly damaging Het
Rabep2 A G 7: 126,444,540 R470G probably damaging Het
Rasal2 T C 1: 157,174,160 Y518C probably damaging Het
Rbmxl1 A G 8: 78,506,082 Y211H probably damaging Het
Rdh7 T C 10: 127,884,585 Y306C probably benign Het
Rtn3 T C 19: 7,457,911 I220V probably damaging Het
Scube1 T C 15: 83,607,437 H952R probably damaging Het
Sf3b1 A G 1: 55,000,652 I690T probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint5 A G 4: 113,563,459 I1108T unknown Het
Snip1 A G 4: 125,071,201 D133G probably benign Het
St3gal3 T C 4: 118,014,774 Y77C probably damaging Het
Sytl3 T C 17: 6,715,481 V112A probably benign Het
Tnxb C T 17: 34,717,970 P3718S probably damaging Het
Ttc24 A T 3: 88,073,094 probably null Het
Ubr3 A T 2: 70,009,129 E1529V probably damaging Het
Utrn T A 10: 12,710,138 H965L probably benign Het
Xrn2 T A 2: 147,061,423 L781Q probably damaging Het
Zbtb11 T C 16: 55,990,682 I401T probably benign Het
Zc3h14 C T 12: 98,758,580 P167L probably damaging Het
Zfp609 G T 9: 65,703,092 S863* probably null Het
Other mutations in Scn8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Scn8a APN 15 100955532 unclassified probably benign
IGL00979:Scn8a APN 15 100955406 unclassified probably benign
IGL01339:Scn8a APN 15 101032201 missense probably benign
IGL01992:Scn8a APN 15 100969057 missense probably damaging 1.00
IGL02215:Scn8a APN 15 101029572 splice site probably null
IGL02311:Scn8a APN 15 101013283 missense probably damaging 0.97
IGL02404:Scn8a APN 15 101039730 missense probably damaging 1.00
IGL02652:Scn8a APN 15 101013476 missense probably damaging 0.98
IGL02690:Scn8a APN 15 100970254 missense probably damaging 1.00
IGL02704:Scn8a APN 15 101008062 missense possibly damaging 0.94
IGL03084:Scn8a APN 15 101017172 missense probably damaging 1.00
IGL03108:Scn8a APN 15 100974615 missense probably benign
IGL03224:Scn8a APN 15 101035639 missense probably damaging 1.00
dan UTSW 15 101035624 nonsense probably null
nymph UTSW 15 101035646 missense probably damaging 1.00
Tremord UTSW 15 101013504 missense probably damaging 1.00
3-1:Scn8a UTSW 15 101039939 missense probably benign 0.04
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0254:Scn8a UTSW 15 101018364 missense probably damaging 1.00
R0412:Scn8a UTSW 15 101008306 splice site probably benign
R0538:Scn8a UTSW 15 101035624 nonsense probably null
R0539:Scn8a UTSW 15 101016568 missense probably damaging 1.00
R0631:Scn8a UTSW 15 101035537 missense probably damaging 1.00
R0726:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R0945:Scn8a UTSW 15 101015787 missense possibly damaging 0.54
R0967:Scn8a UTSW 15 101035646 missense probably damaging 1.00
R1164:Scn8a UTSW 15 101040162 missense probably benign 0.06
R1283:Scn8a UTSW 15 100969171 missense possibly damaging 0.82
R1368:Scn8a UTSW 15 101035541 missense probably damaging 1.00
R1633:Scn8a UTSW 15 101029815 missense probably benign 0.01
R1669:Scn8a UTSW 15 101011120 missense probably damaging 1.00
R1694:Scn8a UTSW 15 100955528 nonsense probably null
R1773:Scn8a UTSW 15 101039615 missense probably damaging 0.97
R1940:Scn8a UTSW 15 100970204 missense probably benign 0.22
R1996:Scn8a UTSW 15 101024379 missense probably damaging 1.00
R2107:Scn8a UTSW 15 101018363 missense probably damaging 0.99
R2251:Scn8a UTSW 15 101017106 missense probably benign 0.02
R2516:Scn8a UTSW 15 100969162 missense probably benign 0.05
R2917:Scn8a UTSW 15 101039732 missense probably damaging 1.00
R3417:Scn8a UTSW 15 100971668 splice site probably benign
R3896:Scn8a UTSW 15 101035498 missense probably benign
R4024:Scn8a UTSW 15 101039793 missense probably damaging 1.00
R4050:Scn8a UTSW 15 101013413 nonsense probably null
R4193:Scn8a UTSW 15 100971603 missense probably damaging 1.00
R4212:Scn8a UTSW 15 100957073 missense possibly damaging 0.88
R4358:Scn8a UTSW 15 100940133 missense probably benign 0.00
R4396:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R4428:Scn8a UTSW 15 100983903 missense probably damaging 1.00
R4452:Scn8a UTSW 15 100957091 missense possibly damaging 0.95
R4631:Scn8a UTSW 15 101016503 nonsense probably null
R4693:Scn8a UTSW 15 101015691 missense probably damaging 1.00
R4765:Scn8a UTSW 15 101040471 missense probably benign 0.07
R4777:Scn8a UTSW 15 101015951 missense probably damaging 1.00
R4949:Scn8a UTSW 15 101029782 missense probably damaging 1.00
R4997:Scn8a UTSW 15 100957054 missense probably damaging 1.00
R5246:Scn8a UTSW 15 101011057 missense probably damaging 1.00
R5566:Scn8a UTSW 15 100974534 missense probably damaging 1.00
R5875:Scn8a UTSW 15 100972822 nonsense probably null
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6057:Scn8a UTSW 15 100974667 missense possibly damaging 0.94
R6114:Scn8a UTSW 15 101040596 missense probably damaging 0.99
R6362:Scn8a UTSW 15 100940115 unclassified probably null
R6535:Scn8a UTSW 15 100959707 intron probably benign
R6677:Scn8a UTSW 15 100969072 missense probably damaging 1.00
R6687:Scn8a UTSW 15 100974627 missense probably benign 0.12
R6701:Scn8a UTSW 15 101040096 missense probably damaging 1.00
R6719:Scn8a UTSW 15 101011015 critical splice acceptor site probably null
R6739:Scn8a UTSW 15 101015955 missense possibly damaging 0.82
R6769:Scn8a UTSW 15 101035564 missense probably benign
R6786:Scn8a UTSW 15 101032215 missense probably benign 0.00
R6849:Scn8a UTSW 15 100955587 intron probably null
X0066:Scn8a UTSW 15 101040080 missense probably damaging 1.00
X0066:Scn8a UTSW 15 101040081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTGAACTTATTTCTGGCCTTGC -3'
(R):5'- GACTCGCTGCTAACATCCTCTGTG -3'

Sequencing Primer
(F):5'- AGCGCAGACAATCTGGC -3'
(R):5'- GGTTCTCGAAATCAGACTCGC -3'
Posted On2014-05-23