Incidental Mutation 'R1735:Tnxb'
ID199682
Institutional Source Beutler Lab
Gene Symbol Tnxb
Ensembl Gene ENSMUSG00000033327
Gene Nametenascin XB
SynonymsTnx, TN-MHC
MMRRC Submission 039767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1735 (G1)
Quality Score202
Status Not validated
Chromosome17
Chromosomal Location34670535-34719815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34717970 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 3718 (P3718S)
Ref Sequence ENSEMBL: ENSMUSP00000084661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087399] [ENSMUST00000168533]
Predicted Effect probably damaging
Transcript: ENSMUST00000087399
AA Change: P3718S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084661
Gene: ENSMUSG00000033327
AA Change: P3718S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 1047 1126 3.97e-5 SMART
FN3 1142 1223 3.62e-8 SMART
low complexity region 1230 1241 N/A INTRINSIC
FN3 1242 1320 2.31e-6 SMART
FN3 1351 1431 8.77e-7 SMART
FN3 1460 1539 3.01e-5 SMART
FN3 1556 1636 2.76e-4 SMART
FN3 1657 1736 5.78e-7 SMART
FN3 1752 1832 4.7e-7 SMART
FN3 1851 1929 1.95e-4 SMART
FN3 1955 2034 4.56e-5 SMART
FN3 2066 2145 2.23e-8 SMART
FN3 2164 2244 7.75e-8 SMART
FN3 2279 2358 8.5e-5 SMART
FN3 2387 2467 2.94e-8 SMART
FN3 2501 2580 1.7e-4 SMART
low complexity region 2588 2598 N/A INTRINSIC
FN3 2607 2687 6.75e-8 SMART
FN3 2716 2795 7.4e-5 SMART
FN3 2822 2902 1.35e-7 SMART
FN3 2931 3010 5.61e-5 SMART
FN3 3026 3106 6.01e-5 SMART
FN3 3120 3199 6.45e-5 SMART
FN3 3214 3293 9.54e-8 SMART
FN3 3316 3396 2.81e-5 SMART
FN3 3416 3502 1.98e-5 SMART
FN3 3518 3596 5.65e-10 SMART
FN3 3607 3682 7.63e-7 SMART
FN3 3695 3770 6.54e-6 SMART
FBG 3787 3997 8.88e-125 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168533
AA Change: P2838S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127487
Gene: ENSMUSG00000033327
AA Change: P2838S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 924 1003 3.97e-5 SMART
FN3 1019 1100 3.62e-8 SMART
low complexity region 1107 1118 N/A INTRINSIC
FN3 1119 1197 2.31e-6 SMART
FN3 1228 1308 8.77e-7 SMART
FN3 1337 1416 3.01e-5 SMART
FN3 1433 1513 2.76e-4 SMART
FN3 1534 1613 5.78e-7 SMART
FN3 1629 1709 4.7e-7 SMART
FN3 1728 1806 1.95e-4 SMART
FN3 1832 1911 4.56e-5 SMART
FN3 1943 2022 2.23e-8 SMART
FN3 2051 2130 5.61e-5 SMART
FN3 2146 2226 6.01e-5 SMART
FN3 2240 2319 6.45e-5 SMART
FN3 2334 2413 9.54e-8 SMART
FN3 2436 2516 2.81e-5 SMART
FN3 2536 2622 1.98e-5 SMART
FN3 2638 2716 5.65e-10 SMART
FN3 2727 2802 7.63e-7 SMART
FN3 2815 2890 6.54e-6 SMART
FBG 2907 3117 8.88e-125 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172970
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.0%
  • 10x: 95.3%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have stretchy skin, similar to patients with human Ehlers-Danlos syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A C 9: 8,027,265 S91A probably benign Het
Acot5 A T 12: 84,075,487 I282F probably benign Het
Adam19 C A 11: 46,138,917 Q730K probably benign Het
Adgrv1 A G 13: 81,487,947 V3481A possibly damaging Het
Akr1c20 T C 13: 4,487,208 D316G probably benign Het
Ap3b1 G A 13: 94,493,717 V827I unknown Het
Aph1a T A 3: 95,895,509 D140E probably damaging Het
Arhgef19 G T 4: 141,249,618 V502L possibly damaging Het
Arl9 T C 5: 77,006,626 F67S probably damaging Het
B430305J03Rik G A 3: 61,363,940 probably benign Het
B4galnt2 A G 11: 95,890,983 F119L probably damaging Het
Bcap29 T A 12: 31,630,840 N49I probably damaging Het
C77080 G T 4: 129,223,577 S476R probably damaging Het
Capn11 T A 17: 45,632,401 K616* probably null Het
Cdh12 T A 15: 21,520,366 Y306N probably damaging Het
Cep350 T A 1: 155,953,214 N315Y probably damaging Het
Cited2 C A 10: 17,724,046 P34Q probably damaging Het
Cmya5 A T 13: 93,089,789 D2930E probably benign Het
Cog3 T A 14: 75,729,321 K470* probably null Het
Commd10 A G 18: 46,990,485 T136A probably benign Het
Csf2ra C A 19: 61,226,344 D181Y probably damaging Het
Csmd1 T A 8: 15,932,610 I2686F probably damaging Het
Dhx29 T C 13: 112,945,086 S415P probably benign Het
Dsel A T 1: 111,860,915 F630Y probably damaging Het
Ell T A 8: 70,578,940 I96N possibly damaging Het
Ephx2 T A 14: 66,088,303 I358L probably benign Het
Fam162b A G 10: 51,587,211 I120T probably damaging Het
Fam187a T C 11: 102,885,780 Y137H probably damaging Het
Fastk T C 5: 24,441,803 E403G probably damaging Het
Fcrlb C A 1: 170,907,332 V409F probably benign Het
Flot2 G T 11: 78,058,005 A269S probably benign Het
Gpd2 T A 2: 57,355,551 N419K probably damaging Het
Hecw1 A T 13: 14,377,765 M61K probably null Het
Htr2a T C 14: 74,706,128 F383L probably damaging Het
Kctd6 C T 14: 8,222,253 R32C probably damaging Het
Khdc1a A G 1: 21,350,965 T125A probably benign Het
Klhl40 T C 9: 121,779,938 S390P probably benign Het
Lonp1 G A 17: 56,614,956 T808I probably damaging Het
Loxhd1 A C 18: 77,404,889 D1342A probably damaging Het
Lrat T C 3: 82,897,110 I187V probably benign Het
Lrif1 T C 3: 106,735,846 *238Q probably null Het
Lrp2bp T C 8: 46,011,988 F48S probably benign Het
Mafg A G 11: 120,629,678 M32T possibly damaging Het
Map4 C T 9: 110,034,955 T416I probably benign Het
N4bp2 T C 5: 65,808,316 F1236S probably damaging Het
Nfatc3 A G 8: 106,083,834 D414G probably damaging Het
Nrip2 T G 6: 128,405,074 V50G probably damaging Het
Olfr1449 T A 19: 12,934,843 I35N probably damaging Het
Olfr16 A G 1: 172,956,807 N4S probably benign Het
Olfr432 A T 1: 174,050,799 K142I probably benign Het
Olfr608 T A 7: 103,470,146 F36I possibly damaging Het
Pcdhb18 A T 18: 37,490,769 H384L probably benign Het
Pik3r1 A T 13: 101,686,374 Y607N probably damaging Het
Plagl2 G A 2: 153,232,477 T168I probably damaging Het
Polr2a A G 11: 69,742,396 S912P probably damaging Het
Ppp1r16b A G 2: 158,761,495 K447E possibly damaging Het
Prkd1 T C 12: 50,342,039 E907G possibly damaging Het
Rabep2 A G 7: 126,444,540 R470G probably damaging Het
Rasal2 T C 1: 157,174,160 Y518C probably damaging Het
Rbmxl1 A G 8: 78,506,082 Y211H probably damaging Het
Rdh7 T C 10: 127,884,585 Y306C probably benign Het
Rtn3 T C 19: 7,457,911 I220V probably damaging Het
Scn8a A G 15: 101,015,861 N1045D possibly damaging Het
Scube1 T C 15: 83,607,437 H952R probably damaging Het
Sf3b1 A G 1: 55,000,652 I690T probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint5 A G 4: 113,563,459 I1108T unknown Het
Snip1 A G 4: 125,071,201 D133G probably benign Het
St3gal3 T C 4: 118,014,774 Y77C probably damaging Het
Sytl3 T C 17: 6,715,481 V112A probably benign Het
Ttc24 A T 3: 88,073,094 probably null Het
Ubr3 A T 2: 70,009,129 E1529V probably damaging Het
Utrn T A 10: 12,710,138 H965L probably benign Het
Xrn2 T A 2: 147,061,423 L781Q probably damaging Het
Zbtb11 T C 16: 55,990,682 I401T probably benign Het
Zc3h14 C T 12: 98,758,580 P167L probably damaging Het
Zfp609 G T 9: 65,703,092 S863* probably null Het
Other mutations in Tnxb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnxb APN 17 34685629 missense probably damaging 1.00
IGL00424:Tnxb APN 17 34714692 missense probably damaging 1.00
IGL00486:Tnxb APN 17 34692382 missense probably damaging 1.00
IGL00952:Tnxb APN 17 34713128 missense probably damaging 1.00
IGL00974:Tnxb APN 17 34718733 critical splice donor site probably null
IGL01017:Tnxb APN 17 34693808 missense probably damaging 0.98
IGL01082:Tnxb APN 17 34714610 missense probably damaging 0.97
IGL01397:Tnxb APN 17 34714673 missense probably damaging 0.99
IGL01473:Tnxb APN 17 34685701 missense probably damaging 0.99
IGL01642:Tnxb APN 17 34718514 missense probably damaging 1.00
IGL01774:Tnxb APN 17 34688839 missense probably damaging 1.00
IGL01971:Tnxb APN 17 34672297 missense probably damaging 1.00
IGL02016:Tnxb APN 17 34672275 missense probably damaging 0.98
IGL02160:Tnxb APN 17 34714745 missense probably benign 0.01
IGL02473:Tnxb APN 17 34717762 missense probably damaging 1.00
IGL02666:Tnxb APN 17 34684939 missense probably benign 0.20
IGL02831:Tnxb APN 17 34703571 missense possibly damaging 0.93
IGL02838:Tnxb APN 17 34689632 missense possibly damaging 0.74
IGL02965:Tnxb APN 17 34709654 missense possibly damaging 0.93
IGL03155:Tnxb APN 17 34713595 missense probably damaging 1.00
IGL03194:Tnxb APN 17 34695947 nonsense probably null
IGL03215:Tnxb APN 17 34692525 missense possibly damaging 0.66
IGL03256:Tnxb APN 17 34688720 missense probably damaging 1.00
E0370:Tnxb UTSW 17 34678943 missense probably damaging 1.00
R0006:Tnxb UTSW 17 34682292 missense probably benign 0.07
R0049:Tnxb UTSW 17 34709568 missense possibly damaging 0.93
R0050:Tnxb UTSW 17 34673325 missense probably damaging 1.00
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0311:Tnxb UTSW 17 34716984 missense probably damaging 0.97
R0326:Tnxb UTSW 17 34698179 missense probably benign 0.32
R0387:Tnxb UTSW 17 34683574 missense probably benign 0.30
R0396:Tnxb UTSW 17 34671733 missense probably damaging 1.00
R0511:Tnxb UTSW 17 34718245 missense probably damaging 0.96
R0540:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0563:Tnxb UTSW 17 34716947 missense probably benign 0.05
R0575:Tnxb UTSW 17 34717206 missense possibly damaging 0.91
R0586:Tnxb UTSW 17 34672144 missense probably damaging 1.00
R0607:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0622:Tnxb UTSW 17 34718729 missense probably damaging 1.00
R0624:Tnxb UTSW 17 34683548 missense probably damaging 1.00
R0709:Tnxb UTSW 17 34689354 missense probably damaging 1.00
R0898:Tnxb UTSW 17 34670745 missense probably damaging 1.00
R0970:Tnxb UTSW 17 34698943 missense possibly damaging 0.85
R0972:Tnxb UTSW 17 34685143 missense probably damaging 1.00
R1118:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1119:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1226:Tnxb UTSW 17 34688929 missense probably damaging 1.00
R1296:Tnxb UTSW 17 34671577 missense probably damaging 1.00
R1297:Tnxb UTSW 17 34710166 missense probably damaging 0.96
R1349:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1356:Tnxb UTSW 17 34695472 missense possibly damaging 0.53
R1372:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1521:Tnxb UTSW 17 34711503 missense probably damaging 1.00
R1522:Tnxb UTSW 17 34718638 missense probably damaging 1.00
R1532:Tnxb UTSW 17 34710830 missense probably damaging 1.00
R1778:Tnxb UTSW 17 34683574 missense probably benign 0.30
R1802:Tnxb UTSW 17 34703889 missense probably damaging 0.98
R1824:Tnxb UTSW 17 34692333 nonsense probably null
R1838:Tnxb UTSW 17 34678910 missense probably damaging 0.96
R1863:Tnxb UTSW 17 34670874 missense probably damaging 1.00
R1865:Tnxb UTSW 17 34703457 nonsense probably null
R1867:Tnxb UTSW 17 34671847 missense probably damaging 1.00
R1883:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1884:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1889:Tnxb UTSW 17 34695825 missense probably damaging 0.97
R1969:Tnxb UTSW 17 34679081 missense probably benign 0.20
R1989:Tnxb UTSW 17 34683377 missense probably benign 0.08
R1989:Tnxb UTSW 17 34693885 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34671904 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R1992:Tnxb UTSW 17 34671904 missense probably damaging 1.00
R2001:Tnxb UTSW 17 34692579 missense possibly damaging 0.82
R2018:Tnxb UTSW 17 34671750 missense probably benign 0.04
R2030:Tnxb UTSW 17 34718469 missense probably damaging 1.00
R2037:Tnxb UTSW 17 34699205 missense probably damaging 1.00
R2103:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R2116:Tnxb UTSW 17 34672227 missense probably damaging 1.00
R2206:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2207:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2215:Tnxb UTSW 17 34704140 missense possibly damaging 0.93
R2413:Tnxb UTSW 17 34718278 missense probably damaging 0.99
R2680:Tnxb UTSW 17 34703620 missense possibly damaging 0.51
R2910:Tnxb UTSW 17 34672450 missense probably damaging 1.00
R2984:Tnxb UTSW 17 34678662 nonsense probably null
R3120:Tnxb UTSW 17 34692355 missense possibly damaging 0.86
R3429:Tnxb UTSW 17 34672631 nonsense probably null
R3429:Tnxb UTSW 17 34703587 missense probably damaging 0.98
R3552:Tnxb UTSW 17 34718721 missense probably damaging 1.00
R3698:Tnxb UTSW 17 34690433 critical splice donor site probably null
R3720:Tnxb UTSW 17 34712964 missense possibly damaging 0.95
R3841:Tnxb UTSW 17 34698923 missense possibly damaging 0.72
R3848:Tnxb UTSW 17 34690395 missense possibly damaging 0.82
R3886:Tnxb UTSW 17 34718911 missense probably damaging 1.00
R4074:Tnxb UTSW 17 34671871 missense probably benign 0.22
R4159:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4160:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4161:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4181:Tnxb UTSW 17 34709454 missense possibly damaging 0.93
R4210:Tnxb UTSW 17 34710977 missense possibly damaging 0.84
R4275:Tnxb UTSW 17 34698231 missense probably damaging 0.98
R4329:Tnxb UTSW 17 34693864 missense probably damaging 1.00
R4394:Tnxb UTSW 17 34678662 nonsense probably null
R4395:Tnxb UTSW 17 34678662 nonsense probably null
R4397:Tnxb UTSW 17 34678662 nonsense probably null
R4540:Tnxb UTSW 17 34703335 missense possibly damaging 0.86
R4673:Tnxb UTSW 17 34672540 missense probably damaging 0.99
R4719:Tnxb UTSW 17 34689420 missense probably damaging 1.00
R4725:Tnxb UTSW 17 34699067 missense probably damaging 0.99
R4753:Tnxb UTSW 17 34695935 missense possibly damaging 0.71
R4777:Tnxb UTSW 17 34671943 missense probably damaging 1.00
R4837:Tnxb UTSW 17 34718007 missense probably damaging 0.98
R4898:Tnxb UTSW 17 34695592 missense possibly damaging 0.95
R4938:Tnxb UTSW 17 34713632 missense probably damaging 1.00
R5044:Tnxb UTSW 17 34717483 missense probably damaging 1.00
R5100:Tnxb UTSW 17 34710928 missense probably damaging 0.99
R5223:Tnxb UTSW 17 34704078 missense possibly damaging 0.51
R5269:Tnxb UTSW 17 34703608 missense possibly damaging 0.95
R5333:Tnxb UTSW 17 34690231 missense probably damaging 1.00
R5454:Tnxb UTSW 17 34709625 missense possibly damaging 0.71
R5470:Tnxb UTSW 17 34716973 missense probably null 1.00
R5475:Tnxb UTSW 17 34689593 missense probably damaging 1.00
R5574:Tnxb UTSW 17 34711024 missense probably benign
R5596:Tnxb UTSW 17 34688804 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690202 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690205 missense probably benign 0.22
R5615:Tnxb UTSW 17 34683418 missense probably damaging 1.00
R5620:Tnxb UTSW 17 34717530 nonsense probably null
R5625:Tnxb UTSW 17 34685211 missense probably benign 0.30
R5734:Tnxb UTSW 17 34698910 missense possibly damaging 0.53
R5896:Tnxb UTSW 17 34672152 missense probably damaging 1.00
R5961:Tnxb UTSW 17 34718635 missense probably damaging 1.00
R5974:Tnxb UTSW 17 34685707 missense probably damaging 1.00
R6091:Tnxb UTSW 17 34710364 missense probably damaging 0.98
R6134:Tnxb UTSW 17 34672012 missense probably damaging 0.96
R6325:Tnxb UTSW 17 34692424 missense probably damaging 1.00
R6358:Tnxb UTSW 17 34678994 missense probably damaging 0.98
R6362:Tnxb UTSW 17 34694388 missense probably damaging 1.00
R6432:Tnxb UTSW 17 34717917 missense probably damaging 1.00
R6461:Tnxb UTSW 17 34671898 missense probably damaging 1.00
R6467:Tnxb UTSW 17 34693924 missense probably damaging 1.00
R6476:Tnxb UTSW 17 34690192 missense probably damaging 0.98
R6477:Tnxb UTSW 17 34719539 missense probably damaging 1.00
R6631:Tnxb UTSW 17 34718248 missense probably damaging 1.00
R6774:Tnxb UTSW 17 34709632 nonsense probably null
R6787:Tnxb UTSW 17 34710736 missense probably benign 0.02
R6805:Tnxb UTSW 17 34698153 missense possibly damaging 0.93
R6860:Tnxb UTSW 17 34713157 missense probably damaging 0.99
R6885:Tnxb UTSW 17 34718519 missense probably damaging 1.00
X0004:Tnxb UTSW 17 34703415 missense possibly damaging 0.71
X0010:Tnxb UTSW 17 34671934 missense probably damaging 1.00
X0019:Tnxb UTSW 17 34694189 missense possibly damaging 0.51
X0063:Tnxb UTSW 17 34703508 missense probably damaging 0.98
X0064:Tnxb UTSW 17 34694032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGATGGATAGGAGCTGATGC -3'
(R):5'- ATTTCCTGGAGACAGACGAGGGAC -3'

Sequencing Primer
(F):5'- TGTGGACTACCCACTGACTG -3'
(R):5'- GAATGCTGATGGCCAGTGAA -3'
Posted On2014-05-23