Incidental Mutation 'R1736:Npffr2'
ID199707
Institutional Source Beutler Lab
Gene Symbol Npffr2
Ensembl Gene ENSMUSG00000035528
Gene Nameneuropeptide FF receptor 2
SynonymsNPFF2, Gpr74
MMRRC Submission 039768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.035) question?
Stock #R1736 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location89527429-89583740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89568066 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 84 (I84N)
Ref Sequence ENSEMBL: ENSMUSP00000040033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048557]
Predicted Effect probably damaging
Transcript: ENSMUST00000048557
AA Change: I84N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040033
Gene: ENSMUSG00000035528
AA Change: I84N

DomainStartEndE-ValueType
Pfam:7tm_4 52 349 3.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 347 3.7e-11 PFAM
Pfam:7tm_1 62 332 4.2e-57 PFAM
Meta Mutation Damage Score 0.478 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of G-protein-coupled neuropeptide receptors. This protein is activated by the neuropeptides A-18-amide (NPAF) and F-8-amide (NPFF) and may function in pain modulation and regulation of the opioid system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adcy3 A G 12: 4,200,998 N586D possibly damaging Het
Ak6 T A 13: 100,655,181 probably null Het
Ankrd66 T C 17: 43,543,518 D41G probably benign Het
Atp8b2 G A 3: 89,952,694 P339S probably damaging Het
BC025446 G A 15: 75,217,720 G26R probably damaging Het
Cacna1d C T 14: 30,089,863 V1297I probably damaging Het
Cbl A T 9: 44,152,895 D781E possibly damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Clint1 A G 11: 45,906,177 probably null Het
Col6a3 A G 1: 90,779,059 Y2111H unknown Het
Csnk1g1 A G 9: 66,019,915 probably null Het
Dse A T 10: 34,153,149 N648K probably damaging Het
Dsp A G 13: 38,192,990 K1584E probably benign Het
Ezh2 A T 6: 47,576,660 M41K probably damaging Het
Fam71e2 A G 7: 4,758,154 S520P probably damaging Het
Fscn2 G A 11: 120,368,026 G466S probably damaging Het
Gm15217 A G 14: 46,383,206 probably benign Het
Gm9696 T C 3: 59,972,275 noncoding transcript Het
Gosr2 G A 11: 103,679,250 Q162* probably null Het
Hectd4 T A 5: 121,349,530 H3529Q possibly damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2c A T 5: 25,290,527 I4074K probably damaging Het
Map3k11 A G 19: 5,697,401 D555G probably benign Het
Mindy2 A G 9: 70,631,030 I341T probably damaging Het
Mrnip G A 11: 50,176,891 probably null Het
Muc5b G A 7: 141,859,107 C1930Y unknown Het
Nfatc3 T G 8: 106,078,850 I109S probably damaging Het
Npas1 G T 7: 16,474,616 A112D probably benign Het
Nxph4 T A 10: 127,526,596 H142L probably damaging Het
Otud4 T A 8: 79,651,665 probably benign Het
Per3 A G 4: 151,009,248 probably null Het
Pigr G A 1: 130,841,803 R117Q possibly damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prex2 T A 1: 11,089,884 probably benign Het
Sall4 G A 2: 168,752,635 P420L probably benign Het
Sap30bp A G 11: 115,964,220 K252R probably damaging Het
Sec63 T A 10: 42,827,918 Y692* probably null Het
Sema3e C T 5: 14,210,376 T181M probably damaging Het
Sf3b3 T C 8: 110,813,832 I986V probably benign Het
Shisa4 A T 1: 135,371,962 Y194* probably null Het
Slc17a6 G A 7: 51,661,585 probably benign Het
Smg1 T G 7: 118,165,967 probably null Het
Smim7 C T 8: 72,571,005 G9R probably damaging Het
Spata31d1d C T 13: 59,726,497 G1075R probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Stag3 T C 5: 138,304,509 probably benign Het
Tbce A G 13: 14,009,642 I217T possibly damaging Het
Tpk1 G A 6: 43,611,350 P27S probably benign Het
Tsc22d1 A G 14: 76,418,357 I2V probably benign Het
Tulp4 T G 17: 6,233,215 V1173G possibly damaging Het
Uchl1 T C 5: 66,677,074 probably null Het
Ugt2b38 T A 5: 87,423,633 Q180L probably benign Het
Other mutations in Npffr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Npffr2 APN 5 89582972 missense probably benign
IGL02308:Npffr2 APN 5 89583451 missense probably benign 0.00
IGL02455:Npffr2 APN 5 89568135 missense probably damaging 1.00
IGL03288:Npffr2 APN 5 89583161 missense probably damaging 1.00
R0309:Npffr2 UTSW 5 89583347 missense probably benign 0.00
R0389:Npffr2 UTSW 5 89582754 missense probably benign 0.15
R1552:Npffr2 UTSW 5 89583116 missense possibly damaging 0.45
R2015:Npffr2 UTSW 5 89582892 missense probably damaging 0.99
R2127:Npffr2 UTSW 5 89568065 missense probably damaging 1.00
R2129:Npffr2 UTSW 5 89568065 missense probably damaging 1.00
R2429:Npffr2 UTSW 5 89583147 missense probably damaging 1.00
R4272:Npffr2 UTSW 5 89568023 missense probably damaging 1.00
R4740:Npffr2 UTSW 5 89583020 nonsense probably null
R5023:Npffr2 UTSW 5 89582687 missense probably benign 0.07
R6386:Npffr2 UTSW 5 89582697 missense probably benign 0.02
R6546:Npffr2 UTSW 5 89583012 missense probably damaging 1.00
X0039:Npffr2 UTSW 5 89583287 missense probably benign 0.16
X0063:Npffr2 UTSW 5 89567985 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TGAGCGAGAAATGGGACTCAAACTC -3'
(R):5'- ATGAACGAATGACTCTGCTCGGAC -3'

Sequencing Primer
(F):5'- TCACATCTGGAGTGGCAATGATAC -3'
(R):5'- ACTCTGGGTATGTGTGGAAAC -3'
Posted On2014-05-23