Incidental Mutation 'R1736:Spata31d1d'
ID199739
Institutional Source Beutler Lab
Gene Symbol Spata31d1d
Ensembl Gene ENSMUSG00000043986
Gene Namespermatogenesis associated 31 subfamily D, member 1D
Synonyms
MMRRC Submission 039768-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1736 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59725925-59731752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59726497 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1075 (G1075R)
Ref Sequence ENSEMBL: ENSMUSP00000128200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052978]
Predicted Effect probably benign
Transcript: ENSMUST00000052978
AA Change: G1075R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128200
Gene: ENSMUSG00000043986
AA Change: G1075R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:DUF4599 70 155 5.4e-28 PFAM
low complexity region 228 238 N/A INTRINSIC
low complexity region 284 298 N/A INTRINSIC
Pfam:FAM75 383 733 2.6e-93 PFAM
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1111 1129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224724
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adcy3 A G 12: 4,200,998 N586D possibly damaging Het
Ak6 T A 13: 100,655,181 probably null Het
Ankrd66 T C 17: 43,543,518 D41G probably benign Het
Atp8b2 G A 3: 89,952,694 P339S probably damaging Het
BC025446 G A 15: 75,217,720 G26R probably damaging Het
Cacna1d C T 14: 30,089,863 V1297I probably damaging Het
Cbl A T 9: 44,152,895 D781E possibly damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Clint1 A G 11: 45,906,177 probably null Het
Col6a3 A G 1: 90,779,059 Y2111H unknown Het
Csnk1g1 A G 9: 66,019,915 probably null Het
Dse A T 10: 34,153,149 N648K probably damaging Het
Dsp A G 13: 38,192,990 K1584E probably benign Het
Ezh2 A T 6: 47,576,660 M41K probably damaging Het
Fam71e2 A G 7: 4,758,154 S520P probably damaging Het
Fscn2 G A 11: 120,368,026 G466S probably damaging Het
Gm15217 A G 14: 46,383,206 probably benign Het
Gm9696 T C 3: 59,972,275 noncoding transcript Het
Gosr2 G A 11: 103,679,250 Q162* probably null Het
Hectd4 T A 5: 121,349,530 H3529Q possibly damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2c A T 5: 25,290,527 I4074K probably damaging Het
Map3k11 A G 19: 5,697,401 D555G probably benign Het
Mindy2 A G 9: 70,631,030 I341T probably damaging Het
Mrnip G A 11: 50,176,891 probably null Het
Muc5b G A 7: 141,859,107 C1930Y unknown Het
Nfatc3 T G 8: 106,078,850 I109S probably damaging Het
Npas1 G T 7: 16,474,616 A112D probably benign Het
Npffr2 T A 5: 89,568,066 I84N probably damaging Het
Nxph4 T A 10: 127,526,596 H142L probably damaging Het
Otud4 T A 8: 79,651,665 probably benign Het
Per3 A G 4: 151,009,248 probably null Het
Pigr G A 1: 130,841,803 R117Q possibly damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prex2 T A 1: 11,089,884 probably benign Het
Sall4 G A 2: 168,752,635 P420L probably benign Het
Sap30bp A G 11: 115,964,220 K252R probably damaging Het
Sec63 T A 10: 42,827,918 Y692* probably null Het
Sema3e C T 5: 14,210,376 T181M probably damaging Het
Sf3b3 T C 8: 110,813,832 I986V probably benign Het
Shisa4 A T 1: 135,371,962 Y194* probably null Het
Slc17a6 G A 7: 51,661,585 probably benign Het
Smg1 T G 7: 118,165,967 probably null Het
Smim7 C T 8: 72,571,005 G9R probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Stag3 T C 5: 138,304,509 probably benign Het
Tbce A G 13: 14,009,642 I217T possibly damaging Het
Tpk1 G A 6: 43,611,350 P27S probably benign Het
Tsc22d1 A G 14: 76,418,357 I2V probably benign Het
Tulp4 T G 17: 6,233,215 V1173G possibly damaging Het
Uchl1 T C 5: 66,677,074 probably null Het
Ugt2b38 T A 5: 87,423,633 Q180L probably benign Het
Other mutations in Spata31d1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Spata31d1d APN 13 59730215 splice site probably benign
IGL02399:Spata31d1d APN 13 59730140 splice site probably benign
IGL02531:Spata31d1d APN 13 59727934 missense possibly damaging 0.86
IGL02687:Spata31d1d APN 13 59727864 missense possibly damaging 0.71
IGL02815:Spata31d1d APN 13 59726864 missense possibly damaging 0.72
IGL02893:Spata31d1d APN 13 59725979 missense possibly damaging 0.72
IGL03037:Spata31d1d APN 13 59726133 missense possibly damaging 0.86
IGL02796:Spata31d1d UTSW 13 59728243 missense possibly damaging 0.93
R0612:Spata31d1d UTSW 13 59727973 missense probably benign 0.06
R1345:Spata31d1d UTSW 13 59726024 missense possibly damaging 0.72
R1572:Spata31d1d UTSW 13 59728191 missense probably benign 0.01
R1750:Spata31d1d UTSW 13 59728695 missense probably benign 0.33
R1894:Spata31d1d UTSW 13 59728122 missense probably benign 0.09
R2202:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2203:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2204:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2913:Spata31d1d UTSW 13 59726955 missense possibly damaging 0.72
R3942:Spata31d1d UTSW 13 59727462 missense probably benign 0.18
R4513:Spata31d1d UTSW 13 59728554 missense probably benign 0.32
R4824:Spata31d1d UTSW 13 59729241 missense possibly damaging 0.86
R4959:Spata31d1d UTSW 13 59727288 missense probably damaging 1.00
R4970:Spata31d1d UTSW 13 59727520 missense probably benign 0.33
R5406:Spata31d1d UTSW 13 59728778 missense probably benign 0.33
R5618:Spata31d1d UTSW 13 59726400 missense probably benign 0.01
R5688:Spata31d1d UTSW 13 59726508 missense probably damaging 0.98
R5741:Spata31d1d UTSW 13 59728686 missense possibly damaging 0.86
R5867:Spata31d1d UTSW 13 59727240 missense possibly damaging 0.53
R5930:Spata31d1d UTSW 13 59727015 missense probably benign
R6263:Spata31d1d UTSW 13 59725983 missense probably benign 0.18
R6267:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6296:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6597:Spata31d1d UTSW 13 59726057 missense probably benign 0.01
R6985:Spata31d1d UTSW 13 59731615 missense probably benign 0.00
R7032:Spata31d1d UTSW 13 59728232 missense probably benign
R7174:Spata31d1d UTSW 13 59728580 missense possibly damaging 0.72
R7322:Spata31d1d UTSW 13 59726976 missense probably benign
R7444:Spata31d1d UTSW 13 59727193 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACTGGGTCTGTTGGGACGCAATAC -3'
(R):5'- GTCTGAACAAGGACAGCCCTCAATC -3'

Sequencing Primer
(F):5'- GGGACGCAATACTCTCTCTTCG -3'
(R):5'- TCAATCTGCCAAGAGGTCGTG -3'
Posted On2014-05-23