Incidental Mutation 'R1737:Olfr59'
ID199800
Institutional Source Beutler Lab
Gene Symbol Olfr59
Ensembl Gene ENSMUSG00000070374
Gene Nameolfactory receptor 59
SynonymsMOR133-3P, IH3, GA_x6K02T2P1NL-4434429-4435400
MMRRC Submission 039769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1737 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74283736-74291608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74288811 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 55 (L55P)
Ref Sequence ENSEMBL: ENSMUSP00000148959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143976] [ENSMUST00000205790] [ENSMUST00000206659] [ENSMUST00000214048]
Predicted Effect probably damaging
Transcript: ENSMUST00000119717
AA Change: L55P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112522
Gene: ENSMUSG00000070374
AA Change: L55P

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 2.2e-59 PFAM
Pfam:7tm_1 41 292 3.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143976
AA Change: L55P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119877
Gene: ENSMUSG00000070374
AA Change: L55P

DomainStartEndE-ValueType
Pfam:7tm_1 41 237 7.5e-34 PFAM
Pfam:7tm_4 139 237 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205790
AA Change: L55P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206659
AA Change: L55P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214048
AA Change: L55P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0244 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.4%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Ak7 G A 12: 105,742,332 V349M probably damaging Het
Aldh1a2 A T 9: 71,285,171 E436V possibly damaging Het
Apc C A 18: 34,317,022 P2290T probably damaging Het
Atp10a T C 7: 58,827,238 probably benign Het
Bahd1 T C 2: 118,915,923 S8P probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Capn10 T C 1: 92,934,955 Y28H probably benign Het
Ccdc129 A T 6: 55,968,304 D670V probably damaging Het
Cdh10 A T 15: 18,964,063 I104F probably damaging Het
Cep170b A G 12: 112,736,627 D508G possibly damaging Het
Ces2a G T 8: 104,740,824 A494S probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cltc G A 11: 86,733,727 T123M probably damaging Het
Cnot1 A G 8: 95,748,276 S1102P probably damaging Het
Col12a1 C A 9: 79,703,451 D224Y probably damaging Het
Col14a1 T A 15: 55,344,961 probably benign Het
Cyp7a1 T A 4: 6,272,848 T122S probably benign Het
Dock4 A G 12: 40,807,001 probably null Het
Eid2 T C 7: 28,268,499 V182A possibly damaging Het
Eloa A T 4: 136,010,770 V293D probably benign Het
Enkur G A 2: 21,194,295 P143S probably damaging Het
Ep300 T C 15: 81,626,347 Y99H probably damaging Het
Fbxw5 C A 2: 25,503,584 L66I probably benign Het
Flg2 A T 3: 93,203,621 R985S unknown Het
Fscb A T 12: 64,474,581 I37K possibly damaging Het
H2-M10.3 T C 17: 36,368,404 N3S probably benign Het
H2-Q7 A C 17: 35,439,626 Y80S probably damaging Het
H60c A T 10: 3,259,914 D124E possibly damaging Het
Hsd3b2 A T 3: 98,711,546 V361E probably damaging Het
Ice1 A C 13: 70,606,325 C547W probably damaging Het
Jmy A G 13: 93,498,795 V171A probably damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Klk1b1 A T 7: 43,970,359 Q114L probably benign Het
Krt10 A G 11: 99,387,387 M280T possibly damaging Het
Lama1 G A 17: 67,802,921 R2179Q probably benign Het
Mbd3l1 C T 9: 18,484,929 P117S possibly damaging Het
Med18 A T 4: 132,460,109 S71R probably damaging Het
Mov10l1 T A 15: 89,011,404 I643N possibly damaging Het
Nfib T C 4: 82,498,589 K70E probably damaging Het
Nr3c2 A C 8: 76,908,329 S20R probably benign Het
Nr6a1 A T 2: 38,738,943 F356L probably benign Het
Oca2 G A 7: 56,328,785 R567H probably damaging Het
Olfr370 A G 8: 83,541,416 S91G probably benign Het
Olfr395 T A 11: 73,907,085 M136L possibly damaging Het
Olfr794 T A 10: 129,570,828 Y58N probably damaging Het
Olfr952 T C 9: 39,426,958 T38A probably damaging Het
Pcdhb10 A G 18: 37,412,956 T362A probably benign Het
Pip5k1b A T 19: 24,397,040 V59E probably damaging Het
Pkhd1l1 G A 15: 44,547,509 probably null Het
Prr36 T C 8: 4,214,370 probably benign Het
Ptger2 A G 14: 45,001,771 T289A probably benign Het
Rad18 A G 6: 112,681,537 F136L probably damaging Het
Rhbg T A 3: 88,245,874 S258C probably damaging Het
Scgb2b27 T C 7: 34,013,314 I34M possibly damaging Het
Senp7 C A 16: 56,123,799 T135K probably damaging Het
Slc20a2 A G 8: 22,545,566 I193M probably damaging Het
Slc27a1 G A 8: 71,570,860 V47I probably benign Het
Slc9a5 G A 8: 105,368,134 V786M probably damaging Het
Smyd1 A G 6: 71,216,891 L350P probably damaging Het
Ston2 A T 12: 91,647,907 F576I probably damaging Het
Sulf2 A T 2: 166,082,678 V496E probably benign Het
Tcl1b3 C A 12: 105,191,222 S41Y probably damaging Het
Tulp2 A T 7: 45,519,777 N256I probably damaging Het
Uspl1 T A 5: 149,201,858 C349S probably damaging Het
Vcl T C 14: 21,020,536 I730T probably damaging Het
Vmn1r61 A T 7: 5,611,061 F85I probably benign Het
Zfp318 A G 17: 46,399,477 T709A probably benign Het
Zfr2 T C 10: 81,242,085 S249P probably damaging Het
Other mutations in Olfr59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Olfr59 APN 11 74289126 missense probably damaging 1.00
IGL00337:Olfr59 APN 11 74289387 missense probably damaging 0.97
IGL01307:Olfr59 APN 11 74289428 missense possibly damaging 0.88
IGL01488:Olfr59 APN 11 74288688 missense probably damaging 1.00
IGL02583:Olfr59 APN 11 74289504 missense probably damaging 1.00
IGL02839:Olfr59 APN 11 74289370 nonsense probably null
IGL02996:Olfr59 APN 11 74289165 missense probably benign 0.08
R0013:Olfr59 UTSW 11 74289051 missense possibly damaging 0.88
R0077:Olfr59 UTSW 11 74288675 missense probably benign 0.00
R0078:Olfr59 UTSW 11 74289266 missense probably damaging 1.00
R0734:Olfr59 UTSW 11 74288946 missense probably damaging 1.00
R1033:Olfr59 UTSW 11 74288666 missense probably damaging 0.99
R1556:Olfr59 UTSW 11 74288936 missense probably damaging 1.00
R1721:Olfr59 UTSW 11 74289300 missense probably damaging 1.00
R1848:Olfr59 UTSW 11 74289213 missense probably damaging 0.99
R1881:Olfr59 UTSW 11 74288666 missense probably benign 0.08
R2057:Olfr59 UTSW 11 74288826 missense probably damaging 1.00
R2107:Olfr59 UTSW 11 74289390 missense probably damaging 1.00
R4399:Olfr59 UTSW 11 74288856 missense probably damaging 1.00
R4633:Olfr59 UTSW 11 74289294 missense probably benign 0.00
R5593:Olfr59 UTSW 11 74288792 missense possibly damaging 0.65
R5988:Olfr59 UTSW 11 74288853 missense probably benign
R6104:Olfr59 UTSW 11 74289366 missense probably damaging 1.00
R7436:Olfr59 UTSW 11 74288685 missense possibly damaging 0.84
R7506:Olfr59 UTSW 11 74289123 missense possibly damaging 0.96
Z1088:Olfr59 UTSW 11 74288835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGACCAGCACCTTTGAGTTCC -3'
(R):5'- CCAACAGGCTGTCACTAAGAGTGAG -3'

Sequencing Primer
(F):5'- AGCACCTTTGAGTTCCTCCTC -3'
(R):5'- AGCGGTCATAGGCCATTG -3'
Posted On2014-05-23