Incidental Mutation 'R1737:Krt10'
ID199802
Institutional Source Beutler Lab
Gene Symbol Krt10
Ensembl Gene ENSMUSG00000019761
Gene Namekeratin 10
SynonymsKrt1-10, suprabasal cytokeratin 10, K10, Krt-1.10, keratin 10, D130054E02Rik, cytokeratin 10, K1C1
MMRRC Submission 039769-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R1737 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99385254-99389364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99387387 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 280 (M280T)
Ref Sequence ENSEMBL: ENSMUSP00000099420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103131] [ENSMUST00000211768]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103131
AA Change: M280T

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099420
Gene: ENSMUSG00000019761
AA Change: M280T

DomainStartEndE-ValueType
low complexity region 2 133 N/A INTRINSIC
Filament 134 448 6e-166 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153599
Predicted Effect probably benign
Transcript: ENSMUST00000211768
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.4%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mutations may result in hyperkeratosis and blistering of the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Ak7 G A 12: 105,742,332 V349M probably damaging Het
Aldh1a2 A T 9: 71,285,171 E436V possibly damaging Het
Apc C A 18: 34,317,022 P2290T probably damaging Het
Atp10a T C 7: 58,827,238 probably benign Het
Bahd1 T C 2: 118,915,923 S8P probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Capn10 T C 1: 92,934,955 Y28H probably benign Het
Ccdc129 A T 6: 55,968,304 D670V probably damaging Het
Cdh10 A T 15: 18,964,063 I104F probably damaging Het
Cep170b A G 12: 112,736,627 D508G possibly damaging Het
Ces2a G T 8: 104,740,824 A494S probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cltc G A 11: 86,733,727 T123M probably damaging Het
Cnot1 A G 8: 95,748,276 S1102P probably damaging Het
Col12a1 C A 9: 79,703,451 D224Y probably damaging Het
Col14a1 T A 15: 55,344,961 probably benign Het
Cyp7a1 T A 4: 6,272,848 T122S probably benign Het
Dock4 A G 12: 40,807,001 probably null Het
Eid2 T C 7: 28,268,499 V182A possibly damaging Het
Eloa A T 4: 136,010,770 V293D probably benign Het
Enkur G A 2: 21,194,295 P143S probably damaging Het
Ep300 T C 15: 81,626,347 Y99H probably damaging Het
Fbxw5 C A 2: 25,503,584 L66I probably benign Het
Flg2 A T 3: 93,203,621 R985S unknown Het
Fscb A T 12: 64,474,581 I37K possibly damaging Het
H2-M10.3 T C 17: 36,368,404 N3S probably benign Het
H2-Q7 A C 17: 35,439,626 Y80S probably damaging Het
H60c A T 10: 3,259,914 D124E possibly damaging Het
Hsd3b2 A T 3: 98,711,546 V361E probably damaging Het
Ice1 A C 13: 70,606,325 C547W probably damaging Het
Jmy A G 13: 93,498,795 V171A probably damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Klk1b1 A T 7: 43,970,359 Q114L probably benign Het
Lama1 G A 17: 67,802,921 R2179Q probably benign Het
Mbd3l1 C T 9: 18,484,929 P117S possibly damaging Het
Med18 A T 4: 132,460,109 S71R probably damaging Het
Mov10l1 T A 15: 89,011,404 I643N possibly damaging Het
Nfib T C 4: 82,498,589 K70E probably damaging Het
Nr3c2 A C 8: 76,908,329 S20R probably benign Het
Nr6a1 A T 2: 38,738,943 F356L probably benign Het
Oca2 G A 7: 56,328,785 R567H probably damaging Het
Olfr370 A G 8: 83,541,416 S91G probably benign Het
Olfr395 T A 11: 73,907,085 M136L possibly damaging Het
Olfr59 T C 11: 74,288,811 L55P probably damaging Het
Olfr794 T A 10: 129,570,828 Y58N probably damaging Het
Olfr952 T C 9: 39,426,958 T38A probably damaging Het
Pcdhb10 A G 18: 37,412,956 T362A probably benign Het
Pip5k1b A T 19: 24,397,040 V59E probably damaging Het
Pkhd1l1 G A 15: 44,547,509 probably null Het
Prr36 T C 8: 4,214,370 probably benign Het
Ptger2 A G 14: 45,001,771 T289A probably benign Het
Rad18 A G 6: 112,681,537 F136L probably damaging Het
Rhbg T A 3: 88,245,874 S258C probably damaging Het
Scgb2b27 T C 7: 34,013,314 I34M possibly damaging Het
Senp7 C A 16: 56,123,799 T135K probably damaging Het
Slc20a2 A G 8: 22,545,566 I193M probably damaging Het
Slc27a1 G A 8: 71,570,860 V47I probably benign Het
Slc9a5 G A 8: 105,368,134 V786M probably damaging Het
Smyd1 A G 6: 71,216,891 L350P probably damaging Het
Ston2 A T 12: 91,647,907 F576I probably damaging Het
Sulf2 A T 2: 166,082,678 V496E probably benign Het
Tcl1b3 C A 12: 105,191,222 S41Y probably damaging Het
Tulp2 A T 7: 45,519,777 N256I probably damaging Het
Uspl1 T A 5: 149,201,858 C349S probably damaging Het
Vcl T C 14: 21,020,536 I730T probably damaging Het
Vmn1r61 A T 7: 5,611,061 F85I probably benign Het
Zfp318 A G 17: 46,399,477 T709A probably benign Het
Zfr2 T C 10: 81,242,085 S249P probably damaging Het
Other mutations in Krt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03179:Krt10 APN 11 99389218 unclassified probably benign
Rough-fur UTSW 11 99388818 missense probably damaging 0.99
FR4304:Krt10 UTSW 11 99386199 unclassified probably benign
FR4304:Krt10 UTSW 11 99389274 unclassified probably benign
FR4340:Krt10 UTSW 11 99386202 unclassified probably benign
FR4340:Krt10 UTSW 11 99386203 unclassified probably benign
FR4340:Krt10 UTSW 11 99389274 unclassified probably benign
FR4342:Krt10 UTSW 11 99386199 unclassified probably benign
FR4342:Krt10 UTSW 11 99386203 unclassified probably benign
FR4449:Krt10 UTSW 11 99389267 unclassified probably benign
FR4548:Krt10 UTSW 11 99389273 unclassified probably benign
FR4548:Krt10 UTSW 11 99389276 unclassified probably benign
FR4589:Krt10 UTSW 11 99389276 unclassified probably benign
FR4737:Krt10 UTSW 11 99386197 unclassified probably benign
FR4737:Krt10 UTSW 11 99389273 unclassified probably benign
FR4737:Krt10 UTSW 11 99389279 unclassified probably benign
R1386:Krt10 UTSW 11 99385920 splice site probably benign
R1553:Krt10 UTSW 11 99385980 nonsense probably null
R2082:Krt10 UTSW 11 99388875 missense probably damaging 1.00
R2420:Krt10 UTSW 11 99387107 missense possibly damaging 0.53
R3409:Krt10 UTSW 11 99387261 missense probably damaging 1.00
R4027:Krt10 UTSW 11 99386193 unclassified probably benign
R4042:Krt10 UTSW 11 99386993 splice site probably null
R4043:Krt10 UTSW 11 99386993 splice site probably null
R4915:Krt10 UTSW 11 99387508 missense probably damaging 0.99
R5818:Krt10 UTSW 11 99388771 missense probably damaging 1.00
R6546:Krt10 UTSW 11 99387395 splice site probably null
R6762:Krt10 UTSW 11 99387057 missense possibly damaging 0.90
R6925:Krt10 UTSW 11 99388851 missense probably damaging 0.99
R6985:Krt10 UTSW 11 99385630 missense possibly damaging 0.66
X0024:Krt10 UTSW 11 99388022 missense probably damaging 1.00
X0062:Krt10 UTSW 11 99387499 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGACCCTGAACAGTACGTCTC -3'
(R):5'- AAGTCTGACCTGGAAATGCAGATCG -3'

Sequencing Primer
(F):5'- CTGAACAGTACGTCTCAATTCAGTG -3'
(R):5'- ACCACGAAGAGGTGACACAA -3'
Posted On2014-05-23