Incidental Mutation 'R1738:Plch1'
ID199839
Institutional Source Beutler Lab
Gene Symbol Plch1
Ensembl Gene ENSMUSG00000036834
Gene Namephospholipase C, eta 1
SynonymsPLCeta1, Plcl3
MMRRC Submission 039770-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1738 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location63696234-63899472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63719238 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 571 (D571E)
Ref Sequence ENSEMBL: ENSMUSP00000124463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]
Predicted Effect probably benign
Transcript: ENSMUST00000048134
AA Change: D552E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: D552E

DomainStartEndE-ValueType
PH 3 112 2.37e-6 SMART
EFh 128 156 2.41e-4 SMART
EFh 164 193 1.54e-2 SMART
Pfam:EF-hand_like 198 280 2.2e-26 PFAM
PLCXc 281 426 3.13e-71 SMART
low complexity region 440 453 N/A INTRINSIC
low complexity region 564 581 N/A INTRINSIC
PLCYc 583 696 3.4e-49 SMART
C2 715 823 5.47e-22 SMART
low complexity region 979 997 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
low complexity region 1420 1435 N/A INTRINSIC
low complexity region 1543 1557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059973
AA Change: D570E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: D570E

DomainStartEndE-ValueType
PH 21 130 1.1e-8 SMART
EFh 146 174 1.1e-6 SMART
EFh 182 211 7.6e-5 SMART
Pfam:EF-hand_like 216 298 4.5e-24 PFAM
PLCXc 299 444 1.6e-73 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 1.7e-51 SMART
C2 733 841 3.7e-24 SMART
low complexity region 1017 1035 N/A INTRINSIC
low complexity region 1117 1129 N/A INTRINSIC
low complexity region 1458 1473 N/A INTRINSIC
low complexity region 1581 1595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084105
AA Change: D571E

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: D571E

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 2.4e-27 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
low complexity region 1018 1036 N/A INTRINSIC
low complexity region 1118 1130 N/A INTRINSIC
low complexity region 1459 1474 N/A INTRINSIC
low complexity region 1582 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159676
AA Change: D571E

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834
AA Change: D571E

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.8e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159982
Predicted Effect probably benign
Transcript: ENSMUST00000160638
AA Change: D571E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834
AA Change: D571E

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 5.3e-28 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162269
AA Change: D571E

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834
AA Change: D571E

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.7e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175947
AA Change: D570E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834
AA Change: D570E

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.2e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 3.4e-49 SMART
C2 733 841 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177143
AA Change: D582E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: D582E

DomainStartEndE-ValueType
PH 33 142 2.37e-6 SMART
EFh 158 186 2.41e-4 SMART
EFh 194 223 1.54e-2 SMART
Pfam:EF-hand_like 228 310 2.3e-26 PFAM
PLCXc 311 456 3.13e-71 SMART
low complexity region 470 483 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
PLCYc 613 726 3.4e-49 SMART
C2 745 853 5.47e-22 SMART
low complexity region 1009 1027 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1450 1465 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.7%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,611 Y202C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl3 T G 5: 81,387,979 M155R probably damaging Het
Ak9 A T 10: 41,335,921 Q218L possibly damaging Het
Akap13 G A 7: 75,677,194 G647D probably damaging Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Arhgap19 A G 19: 41,784,381 I291T probably benign Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
BC067074 T G 13: 113,367,500 L179R possibly damaging Het
Bsn T C 9: 108,106,934 D3307G unknown Het
Ces2h T A 8: 105,019,065 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a3 T C 1: 90,816,361 E88G probably damaging Het
Coro6 A G 11: 77,469,425 D407G probably benign Het
Cpe A T 8: 64,611,441 F241L probably damaging Het
Csde1 A G 3: 103,029,177 probably benign Het
Dgki A G 6: 37,057,432 I361T possibly damaging Het
Dnah3 A G 7: 120,035,359 V1298A probably damaging Het
Duox2 T A 2: 122,293,414 I430F probably damaging Het
Gak T C 5: 108,616,976 Y153C probably damaging Het
Gal3st2 T A 1: 93,874,596 probably null Het
Gbp11 T C 5: 105,326,644 N389D probably benign Het
Grm1 A G 10: 10,936,419 V287A probably damaging Het
Hsp90ab1 T C 17: 45,571,806 K36E probably damaging Het
Il24 T A 1: 130,887,362 probably null Het
Ino80d T C 1: 63,093,465 D13G probably damaging Het
Ipp G A 4: 116,530,421 V399I probably benign Het
Kank3 A T 17: 33,817,194 D12V probably damaging Het
Lcn12 A T 2: 25,493,251 S74R probably damaging Het
Mast3 T C 8: 70,784,556 T637A probably benign Het
Nes C A 3: 87,976,421 Y662* probably null Het
Nudt13 A T 14: 20,309,694 H163L probably damaging Het
Olfr1046 A T 2: 86,217,716 probably null Het
Olfr1178 G A 2: 88,391,327 V27I probably benign Het
Olfr1239 T C 2: 89,418,018 T132A probably benign Het
Olfr346 T C 2: 36,688,785 V261A probably benign Het
Pde6b C T 5: 108,430,559 R788* probably null Het
Pex13 A G 11: 23,649,458 L351P probably benign Het
Phc1 A G 6: 122,318,566 M942T probably damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhh2 A G 17: 84,566,697 N470S possibly damaging Het
Primpol A G 8: 46,607,838 S82P probably damaging Het
Prkg1 T C 19: 30,786,922 D256G possibly damaging Het
Prune2 A G 19: 17,125,010 E2511G probably benign Het
Rassf8 T C 6: 145,815,308 I120T probably benign Het
Rfx4 G A 10: 84,880,975 probably null Het
Rtp2 A T 16: 23,927,673 N69K probably benign Het
Sh3d19 A T 3: 86,120,606 I597F probably damaging Het
Sorl1 T A 9: 42,089,965 E246D probably benign Het
Spert C T 14: 75,593,057 M1I probably null Het
Tet2 T A 3: 133,481,387 I1094L probably benign Het
Tlr4 A T 4: 66,841,076 H702L probably benign Het
Tnfrsf14 T C 4: 154,925,331 D47G probably damaging Het
Ttn T C 2: 76,946,813 Y1415C probably damaging Het
Vmn2r17 T A 5: 109,428,511 F416Y probably benign Het
Vmn2r54 A G 7: 12,635,888 S83P probably benign Het
Vtn A G 11: 78,499,596 D53G possibly damaging Het
Vwde A T 6: 13,190,724 V456D probably damaging Het
Wdr91 G A 6: 34,884,308 P653L probably damaging Het
Ythdf1 G A 2: 180,911,492 A283V probably benign Het
Zfp975 C A 7: 42,662,949 W80L probably benign Het
Other mutations in Plch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Plch1 APN 3 63731729 splice site probably null
IGL01542:Plch1 APN 3 63731649 missense probably damaging 0.99
IGL01999:Plch1 APN 3 63753307 missense probably damaging 1.00
IGL02153:Plch1 APN 3 63781351 missense probably damaging 1.00
IGL02203:Plch1 APN 3 63698739 missense possibly damaging 0.46
IGL02220:Plch1 APN 3 63698961 missense probably damaging 0.97
IGL02259:Plch1 APN 3 63722749 critical splice donor site probably null
IGL02268:Plch1 APN 3 63699283 makesense probably null
IGL02411:Plch1 APN 3 63697756 unclassified probably null
IGL02472:Plch1 APN 3 63701849 missense probably damaging 1.00
IGL02477:Plch1 APN 3 63753293 missense probably damaging 1.00
IGL02503:Plch1 APN 3 63697864 missense probably damaging 1.00
IGL02800:Plch1 APN 3 63698478 missense probably benign 0.21
IGL03167:Plch1 APN 3 63722744 splice site probably benign
IGL03182:Plch1 APN 3 63702594 nonsense probably null
IGL03197:Plch1 APN 3 63753170 missense probably damaging 1.00
IGL03251:Plch1 APN 3 63784002 missense possibly damaging 0.93
R0335:Plch1 UTSW 3 63710978 missense probably damaging 1.00
R0347:Plch1 UTSW 3 63753316 missense probably damaging 1.00
R0631:Plch1 UTSW 3 63699219 missense probably benign 0.23
R0687:Plch1 UTSW 3 63716029 missense probably damaging 1.00
R0738:Plch1 UTSW 3 63702553 intron probably benign
R0883:Plch1 UTSW 3 63753256 missense probably damaging 1.00
R1437:Plch1 UTSW 3 63697533 missense probably benign 0.37
R1678:Plch1 UTSW 3 63740694 missense probably damaging 1.00
R1929:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R1955:Plch1 UTSW 3 63755267 missense probably damaging 0.98
R2078:Plch1 UTSW 3 63701943 missense probably benign 0.01
R2112:Plch1 UTSW 3 63722806 missense probably damaging 1.00
R2158:Plch1 UTSW 3 63721234 missense probably benign 0.00
R2165:Plch1 UTSW 3 63698482 missense probably benign 0.01
R2259:Plch1 UTSW 3 63697977 missense possibly damaging 0.94
R2271:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R3110:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3112:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3407:Plch1 UTSW 3 63699347 unclassified probably benign
R3408:Plch1 UTSW 3 63699347 unclassified probably benign
R3791:Plch1 UTSW 3 63699523 missense probably benign
R3793:Plch1 UTSW 3 63697831 missense probably damaging 0.96
R3928:Plch1 UTSW 3 63767623 missense probably damaging 1.00
R4211:Plch1 UTSW 3 63711219 missense probably damaging 1.00
R4212:Plch1 UTSW 3 63870759 start gained probably benign
R4223:Plch1 UTSW 3 63701900 missense probably damaging 1.00
R4491:Plch1 UTSW 3 63740739 missense probably damaging 1.00
R4589:Plch1 UTSW 3 63781507 missense probably damaging 1.00
R4656:Plch1 UTSW 3 63704177 missense probably damaging 1.00
R4701:Plch1 UTSW 3 63699496 intron probably null
R4716:Plch1 UTSW 3 63781546 missense probably damaging 1.00
R4772:Plch1 UTSW 3 63753325 missense probably damaging 1.00
R4902:Plch1 UTSW 3 63740843 intron probably benign
R5058:Plch1 UTSW 3 63722781 missense probably damaging 1.00
R5092:Plch1 UTSW 3 63698710 missense probably benign 0.02
R5093:Plch1 UTSW 3 63773715 missense probably damaging 0.99
R5210:Plch1 UTSW 3 63699778 critical splice donor site probably null
R5368:Plch1 UTSW 3 63701973 missense possibly damaging 0.82
R5373:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5374:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5501:Plch1 UTSW 3 63707741 missense probably damaging 1.00
R5606:Plch1 UTSW 3 63740687 missense probably benign 0.35
R5738:Plch1 UTSW 3 63773655 missense probably damaging 1.00
R5835:Plch1 UTSW 3 63697522 missense probably benign
R6106:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6107:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6108:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6110:Plch1 UTSW 3 63698858 missense possibly damaging 0.62
R6116:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6147:Plch1 UTSW 3 63722881 missense probably damaging 1.00
R6195:Plch1 UTSW 3 63740789 missense probably damaging 1.00
R6315:Plch1 UTSW 3 63781390 nonsense probably null
R6316:Plch1 UTSW 3 63781390 nonsense probably null
R6317:Plch1 UTSW 3 63781390 nonsense probably null
R6318:Plch1 UTSW 3 63781390 nonsense probably null
R6324:Plch1 UTSW 3 63781390 nonsense probably null
R6325:Plch1 UTSW 3 63781390 nonsense probably null
R6326:Plch1 UTSW 3 63781390 nonsense probably null
R6479:Plch1 UTSW 3 63744510 missense probably benign 0.06
R6544:Plch1 UTSW 3 63850978 missense probably damaging 1.00
R6767:Plch1 UTSW 3 63755344 missense probably damaging 1.00
R6829:Plch1 UTSW 3 63697518 missense probably damaging 0.99
R6891:Plch1 UTSW 3 63698083 missense probably benign
R6893:Plch1 UTSW 3 63753141 nonsense probably null
R6921:Plch1 UTSW 3 63707734 missense possibly damaging 0.90
X0028:Plch1 UTSW 3 63744509 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGTCTTCTGTACATCTGCATGGGC -3'
(R):5'- GCTGAATAAGTAGCTGGTCACTCCTTC -3'

Sequencing Primer
(F):5'- TAGCACTTATTCAGGACCCCG -3'
(R):5'- CCCATCCCACTtgtgtgtg -3'
Posted On2014-05-23