Incidental Mutation 'R0087:Mppe1'
ID19987
Institutional Source Beutler Lab
Gene Symbol Mppe1
Ensembl Gene ENSMUSG00000062526
Gene Namemetallophosphoesterase 1
Synonyms
MMRRC Submission 038374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0087 (G1)
Quality Score123
Status Validated (trace)
Chromosome18
Chromosomal Location67225530-67245830 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 67225704 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 398 (*398R)
Ref Sequence ENSEMBL: ENSMUSP00000072808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025402] [ENSMUST00000073054] [ENSMUST00000076605]
Predicted Effect probably benign
Transcript: ENSMUST00000025402
SMART Domains Protein: ENSMUSP00000025402
Gene: ENSMUSG00000024524

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
G_alpha 89 447 1.18e-172 SMART
Predicted Effect probably null
Transcript: ENSMUST00000073054
AA Change: *398R
SMART Domains Protein: ENSMUSP00000072808
Gene: ENSMUSG00000062526
AA Change: *398R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Metallophos 68 308 3.3e-13 PFAM
transmembrane domain 358 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076605
SMART Domains Protein: ENSMUSP00000075908
Gene: ENSMUSG00000024524

DomainStartEndE-ValueType
G_alpha 22 380 5.02e-176 SMART
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.5%
  • 20x: 82.3%
Validation Efficiency 86% (59/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Adgrv1 T A 13: 81,386,951 I5732F probably damaging Het
Adss A T 1: 177,771,222 V330E probably benign Het
Agps T A 2: 75,909,635 Y488N probably damaging Het
Ap3s1 A T 18: 46,758,039 R66S probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp2a2 C T 5: 122,460,961 V593I probably benign Het
Chrna6 C T 8: 27,406,986 V288M probably damaging Het
Col4a2 C T 8: 11,441,296 L1232F probably benign Het
Dcaf1 A G 9: 106,863,089 N1225D probably damaging Het
Degs1 A G 1: 182,279,310 I128T probably benign Het
Dnah5 A T 15: 28,350,613 T2594S probably damaging Het
Dnah8 G T 17: 30,755,119 R2826L probably damaging Het
Elf3 A G 1: 135,257,137 Y104H probably damaging Het
Fam222b C A 11: 78,153,892 T93N probably benign Het
Fbxw26 A G 9: 109,724,938 I211T probably benign Het
Fcho2 T C 13: 98,735,086 T541A probably benign Het
Flg2 T C 3: 93,202,431 S589P unknown Het
Foxj3 T A 4: 119,626,400 V589E unknown Het
Gria1 A G 11: 57,317,712 Y742C probably damaging Het
Inpp5d T C 1: 87,715,138 S672P probably damaging Het
Lrrc19 A C 4: 94,640,772 F91C probably damaging Het
Lrrc6 T C 15: 66,469,975 T91A probably benign Het
Mroh3 T C 1: 136,190,803 I561V probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Nbea G T 3: 56,091,023 T121K possibly damaging Het
Nbr1 A C 11: 101,564,693 D91A probably benign Het
Ncam2 C A 16: 81,434,901 N84K probably benign Het
Olfr1260 T C 2: 89,978,131 Y118H probably damaging Het
Olfr616 A T 7: 103,564,362 C306S probably benign Het
Olfr618 A G 7: 103,597,721 Y135C probably benign Het
Olfr651 A G 7: 104,553,662 I248V possibly damaging Het
Olfr711 A G 7: 106,972,116 V76A probably benign Het
Pdgfrb A T 18: 61,061,513 I121F probably damaging Het
Peak1 A T 9: 56,258,325 I773N probably damaging Het
Pfkfb4 G T 9: 109,007,701 V155F probably damaging Het
Pkm C T 9: 59,678,099 R455* probably null Het
Plbd2 C A 5: 120,494,485 E151* probably null Het
Pld5 G A 1: 175,984,459 T353M probably damaging Het
Psme2b A T 11: 48,945,717 D134E possibly damaging Het
Rida T A 15: 34,488,626 D40V possibly damaging Het
Rnf126 A T 10: 79,759,234 H265Q probably damaging Het
Rock2 C A 12: 16,928,966 Q86K probably benign Het
Serpinb1b A T 13: 33,085,319 T12S probably benign Het
Slco6c1 T A 1: 97,118,578 Q277L probably benign Het
Sptlc2 T A 12: 87,369,118 H45L probably benign Het
Srsf4 A G 4: 131,900,330 probably benign Het
Sspo A G 6: 48,477,785 S2969G probably damaging Het
Steap1 C T 5: 5,736,664 G258R probably damaging Het
Stk19 A T 17: 34,836,875 M1K probably null Het
Stk-ps2 C A 1: 46,029,889 noncoding transcript Het
Taf1c C T 8: 119,600,987 R332H probably damaging Het
Thbs4 T A 13: 92,755,235 T791S probably damaging Het
Theg A T 10: 79,585,951 Y144* probably null Het
Tjap1 A G 17: 46,263,726 L21P probably damaging Het
Tmem145 A G 7: 25,307,843 Y148C probably damaging Het
Tmem267 T A 13: 119,609,274 V155E probably benign Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Tyro3 T G 2: 119,801,701 I83S probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r53 A T 6: 90,223,431 C304S probably benign Het
Vwf G A 6: 125,645,954 M1761I probably benign Het
Zfp276 T C 8: 123,265,047 Y445H probably damaging Het
Zfp407 A T 18: 84,560,411 I859N probably damaging Het
Other mutations in Mppe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Mppe1 APN 18 67237444 nonsense probably null
IGL03028:Mppe1 APN 18 67227684 missense probably damaging 1.00
R0538:Mppe1 UTSW 18 67237477 missense probably damaging 1.00
R0552:Mppe1 UTSW 18 67237348 critical splice donor site probably null
R1170:Mppe1 UTSW 18 67227706 missense probably damaging 1.00
R1970:Mppe1 UTSW 18 67229772 missense probably benign 0.07
R2229:Mppe1 UTSW 18 67228011 critical splice donor site probably null
R3874:Mppe1 UTSW 18 67225886 critical splice acceptor site probably null
R4194:Mppe1 UTSW 18 67228068 missense probably benign 0.27
R4775:Mppe1 UTSW 18 67226859 missense possibly damaging 0.96
R4940:Mppe1 UTSW 18 67228024 missense probably damaging 1.00
R4974:Mppe1 UTSW 18 67228062 missense probably benign
R4979:Mppe1 UTSW 18 67229702 missense probably damaging 1.00
R5768:Mppe1 UTSW 18 67225818 missense possibly damaging 0.87
R5784:Mppe1 UTSW 18 67228027 missense probably benign 0.12
R5895:Mppe1 UTSW 18 67225763 missense probably benign 0.00
R6547:Mppe1 UTSW 18 67228988 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTGGAAGAAAGGACTGTGTGTC -3'
(R):5'- GATTACGCTCTGTCCAAGTGCTACC -3'

Sequencing Primer
(F):5'- GGTAGTGTCCATGACATTTACATTCC -3'
(R):5'- AAGTGCTACCTCCCGTTTGAG -3'
Posted On2013-04-11