Incidental Mutation 'R1739:Abcb11'
ID200148
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission 039771-MU
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1739 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69261566 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 871 (A871T)
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect probably damaging
Transcript: ENSMUST00000102709
AA Change: A871T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: A871T

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102710
AA Change: A871T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: A871T

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126240
Predicted Effect probably damaging
Transcript: ENSMUST00000180142
AA Change: A871T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: A871T

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 231 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,278,306 T1059I probably benign Het
Acot7 T C 4: 152,260,912 L313P probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Adam26b T A 8: 43,521,677 D96V probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Apbb1 A G 7: 105,574,227 V59A probably benign Het
Apc A G 18: 34,312,318 K722E probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Aspscr1 A G 11: 120,678,516 T47A probably damaging Het
Atr G A 9: 95,897,581 V1331I probably benign Het
Baz1a G A 12: 54,898,788 R1261* probably null Het
C2cd2l C A 9: 44,319,743 R49L probably benign Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1c A C 6: 118,610,544 M1287R probably damaging Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc177 A G 12: 80,759,239 V87A probably damaging Het
Ccdc178 T A 18: 22,097,723 I364F possibly damaging Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cep120 A G 18: 53,719,214 probably null Het
Cep128 G T 12: 91,022,491 probably null Het
Cep131 T C 11: 120,083,906 I23V probably benign Het
Cfc1 A G 1: 34,537,234 D125G probably damaging Het
Cfh T C 1: 140,136,788 K374R probably benign Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Clca1 C A 3: 145,007,778 M697I probably benign Het
Clec4a3 C T 6: 122,954,041 Q30* probably null Het
Cntnap3 T A 13: 64,740,592 R1232S probably benign Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Col12a1 T A 9: 79,633,468 I2412F probably damaging Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Cxcl2 C T 5: 90,904,158 T41I probably damaging Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Disp2 T C 2: 118,791,550 V921A probably damaging Het
Dnajc10 C G 2: 80,347,662 A671G probably benign Het
Dner T C 1: 84,370,784 I732V probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Dysf T C 6: 84,112,235 probably null Het
Eefsec T A 6: 88,376,205 K161* probably null Het
Ehhadh G C 16: 21,762,253 A663G probably benign Het
En1 A G 1: 120,603,621 S197G unknown Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Exph5 T C 9: 53,375,588 V1323A possibly damaging Het
Eya2 G T 2: 165,687,663 G109W probably damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Focad T C 4: 88,397,891 M1560T probably benign Het
Gadd45gip1 T A 8: 84,832,292 M1K probably null Het
Gbgt1 T C 2: 28,505,052 V234A possibly damaging Het
Gin1 T A 1: 97,786,104 D376E probably damaging Het
Git1 A T 11: 77,498,982 I24F probably damaging Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Gm5152 T C 5: 10,245,204 I90V possibly damaging Het
Gnptab T C 10: 88,436,095 Y916H probably benign Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Heg1 T G 16: 33,738,583 I1058S possibly damaging Het
Hivep3 A G 4: 120,095,174 Y229C probably benign Het
Idi1 T C 13: 8,890,411 F210L probably benign Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kat7 T G 11: 95,276,547 I455L possibly damaging Het
Kcnh5 G T 12: 75,114,229 P302T probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Krtap12-1 C T 10: 77,720,992 T123I possibly damaging Het
Ksr1 G A 11: 79,047,305 T49I probably damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lat2 T C 5: 134,606,369 H89R possibly damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Man2a2 T C 7: 80,362,438 E657G probably benign Het
Mfsd4a C T 1: 132,067,883 D4N possibly damaging Het
Mn1 G T 5: 111,420,014 A617S possibly damaging Het
Mov10 T C 3: 104,800,282 D592G probably damaging Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mtmr12 A T 15: 12,245,019 T207S probably benign Het
Musk G A 4: 58,293,563 V51M probably damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Naglu C T 11: 101,076,403 A393V possibly damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ncan T A 8: 70,108,086 T744S probably benign Het
Nlrp4c T A 7: 6,073,222 V707E probably damaging Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrcam A T 12: 44,571,675 Q822L probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1232 T A 2: 89,325,566 I205F probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pak1 T A 7: 97,904,695 V424E probably damaging Het
Pdcd6 G A 13: 74,304,041 T160I probably damaging Het
Phf21a C T 2: 92,360,299 T535M possibly damaging Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pkdrej G A 15: 85,820,427 T436I probably benign Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppil2 C G 16: 17,089,419 probably benign Het
Ppip5k2 A T 1: 97,728,957 H830Q probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A C 1: 133,356,457 K187Q probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep C G 1: 135,283,629 R127P probably benign Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G T 1: 120,063,246 E453D probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sema4a A G 3: 88,436,838 L702P possibly damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Shank2 A T 7: 144,179,853 N482Y probably damaging Het
Shc3 A T 13: 51,482,916 V72E probably damaging Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc45a4 A G 15: 73,586,038 I562T probably damaging Het
Smc6 T G 12: 11,317,853 V1088G probably benign Het
Snx32 C A 19: 5,496,111 R341L probably benign Het
Specc1 C T 11: 62,118,818 Q467* probably null Het
Spock3 A T 8: 63,348,947 N323I probably damaging Het
Stac3 A G 10: 127,507,766 K259R probably benign Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Stx3 A G 19: 11,785,523 I163T probably damaging Het
Suco A G 1: 161,827,655 probably null Het
Syngr4 A G 7: 45,888,722 F74S possibly damaging Het
Synpo2l G A 14: 20,665,819 P233S probably damaging Het
Tcf4 A T 18: 69,642,970 T163S probably damaging Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tlk1 T C 2: 70,721,077 Y634C probably damaging Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Tox2 T C 2: 163,247,785 Y66H probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ttyh1 G A 7: 4,129,349 M261I probably benign Het
Ubap2 A G 4: 41,206,849 V509A probably benign Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Ucp3 G C 7: 100,482,720 M259I probably benign Het
Unc80 A T 1: 66,527,892 N886Y probably damaging Het
Vmn1r197 T A 13: 22,328,371 L154Q possibly damaging Het
Vmn1r40 T A 6: 89,714,315 M38K probably benign Het
Vmn2r78 C A 7: 86,920,789 Q172K probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfhx4 A T 3: 5,401,730 D2316V probably damaging Het
Zfp108 T C 7: 24,261,310 V442A probably damaging Het
Zfp260 A T 7: 30,104,806 T44S probably benign Het
Zfp873 C A 10: 82,060,707 T424N probably damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Zswim2 T A 2: 83,915,340 K585* probably null Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Predicted Primers
Posted On2014-05-23