Incidental Mutation 'R1739:Tcf4'
ID200242
Institutional Source Beutler Lab
Gene Symbol Tcf4
Ensembl Gene ENSMUSG00000053477
Gene Nametranscription factor 4
SynonymsMITF-2B, ITF-2, MITF-2A, ME2, SEF2-1, 5730422P05Rik, ASP-I2, SEF-2, bHLHb19, TFE, E2.2, ITF-2b, E2-2
MMRRC Submission 039771-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1739 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location69343356-69689079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69642970 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 163 (T163S)
Ref Sequence ENSEMBL: ENSMUSP00000147155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066717] [ENSMUST00000078486] [ENSMUST00000114977] [ENSMUST00000114978] [ENSMUST00000114980] [ENSMUST00000114982] [ENSMUST00000114985] [ENSMUST00000145918] [ENSMUST00000200703] [ENSMUST00000200862] [ENSMUST00000200921] [ENSMUST00000200966] [ENSMUST00000201037] [ENSMUST00000201091] [ENSMUST00000201094] [ENSMUST00000201124] [ENSMUST00000201205] [ENSMUST00000201410] [ENSMUST00000201631] [ENSMUST00000201781] [ENSMUST00000201964] [ENSMUST00000202057] [ENSMUST00000202116] [ENSMUST00000202350] [ENSMUST00000202354] [ENSMUST00000202435] [ENSMUST00000202458] [ENSMUST00000202474] [ENSMUST00000202477] [ENSMUST00000202610] [ENSMUST00000202674] [ENSMUST00000202751] [ENSMUST00000202765] [ENSMUST00000202772] [ENSMUST00000202937] [ENSMUST00000209116] [ENSMUST00000209174]
Predicted Effect probably benign
Transcript: ENSMUST00000066717
AA Change: T314S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067318
Gene: ENSMUSG00000053477
AA Change: T314S

DomainStartEndE-ValueType
low complexity region 244 252 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 488 501 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
HLH 595 648 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078486
AA Change: T292S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077577
Gene: ENSMUSG00000053477
AA Change: T292S

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
HLH 573 626 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114977
AA Change: T133S

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110628
Gene: ENSMUSG00000053477
AA Change: T133S

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
HLH 410 463 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114978
AA Change: T133S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000110629
Gene: ENSMUSG00000053477
AA Change: T133S

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 383 N/A INTRINSIC
HLH 414 467 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114980
AA Change: T292S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110631
Gene: ENSMUSG00000053477
AA Change: T292S

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114982
AA Change: T292S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110633
Gene: ENSMUSG00000053477
AA Change: T292S

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114985
AA Change: T292S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110636
Gene: ENSMUSG00000053477
AA Change: T292S

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
HLH 573 626 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145918
AA Change: T77S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000144298
Gene: ENSMUSG00000053477
AA Change: T77S

DomainStartEndE-ValueType
low complexity region 7 15 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200703
AA Change: T77S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000144583
Gene: ENSMUSG00000053477
AA Change: T77S

DomainStartEndE-ValueType
low complexity region 7 15 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200862
AA Change: T163S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144338
Gene: ENSMUSG00000053477
AA Change: T163S

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200902
Predicted Effect probably benign
Transcript: ENSMUST00000200921
AA Change: T77S

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143892
Gene: ENSMUSG00000053477
AA Change: T77S

DomainStartEndE-ValueType
low complexity region 7 15 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200966
AA Change: T163S

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144045
Gene: ENSMUSG00000053477
AA Change: T163S

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201037
AA Change: T53S

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144488
Gene: ENSMUSG00000053477
AA Change: T53S

DomainStartEndE-ValueType
low complexity region 97 108 N/A INTRINSIC
low complexity region 191 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201045
Predicted Effect probably benign
Transcript: ENSMUST00000201091
AA Change: T133S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144386
Gene: ENSMUSG00000053477
AA Change: T133S

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201094
AA Change: T163S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144169
Gene: ENSMUSG00000053477
AA Change: T163S

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201124
SMART Domains Protein: ENSMUSP00000144080
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 145 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201157
Predicted Effect probably benign
Transcript: ENSMUST00000201205
AA Change: T163S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144273
Gene: ENSMUSG00000053477
AA Change: T163S

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 413 N/A INTRINSIC
HLH 444 497 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201410
AA Change: T163S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143950
Gene: ENSMUSG00000053477
AA Change: T163S

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201631
AA Change: T268S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144285
Gene: ENSMUSG00000053477
AA Change: T268S

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 521 N/A INTRINSIC
HLH 545 598 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201781
AA Change: T268S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144209
Gene: ENSMUSG00000053477
AA Change: T268S

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
HLH 549 602 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201964
AA Change: T77S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144070
Gene: ENSMUSG00000053477
AA Change: T77S

DomainStartEndE-ValueType
low complexity region 7 15 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202057
AA Change: T163S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144647
Gene: ENSMUSG00000053477
AA Change: T163S

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202116
AA Change: T292S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144512
Gene: ENSMUSG00000053477
AA Change: T292S

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202350
SMART Domains Protein: ENSMUSP00000144154
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202354
AA Change: T268S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144646
Gene: ENSMUSG00000053477
AA Change: T268S

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
low complexity region 477 495 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
HLH 544 597 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202435
AA Change: T268S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144407
Gene: ENSMUSG00000053477
AA Change: T268S

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
HLH 549 602 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202458
AA Change: T213S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143875
Gene: ENSMUSG00000053477
AA Change: T213S

DomainStartEndE-ValueType
low complexity region 143 151 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 387 400 N/A INTRINSIC
low complexity region 423 441 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
HLH 490 543 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202474
AA Change: T133S

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143820
Gene: ENSMUSG00000053477
AA Change: T133S

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
HLH 410 463 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202477
AA Change: T163S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144219
Gene: ENSMUSG00000053477
AA Change: T163S

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202610
AA Change: T232S

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144670
Gene: ENSMUSG00000053477
AA Change: T232S

DomainStartEndE-ValueType
low complexity region 162 170 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
low complexity region 442 460 N/A INTRINSIC
low complexity region 464 482 N/A INTRINSIC
HLH 513 566 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202674
AA Change: T267S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144221
Gene: ENSMUSG00000053477
AA Change: T267S

DomainStartEndE-ValueType
low complexity region 197 205 N/A INTRINSIC
low complexity region 311 322 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
low complexity region 477 495 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
HLH 544 597 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202751
AA Change: T133S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144064
Gene: ENSMUSG00000053477
AA Change: T133S

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202765
AA Change: T163S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144332
Gene: ENSMUSG00000053477
AA Change: T163S

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202772
AA Change: T232S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143987
Gene: ENSMUSG00000053477
AA Change: T232S

DomainStartEndE-ValueType
low complexity region 162 170 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
low complexity region 442 460 N/A INTRINSIC
low complexity region 464 485 N/A INTRINSIC
HLH 509 562 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202937
AA Change: T163S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143857
Gene: ENSMUSG00000053477
AA Change: T163S

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 413 N/A INTRINSIC
HLH 444 497 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209116
Predicted Effect probably damaging
Transcript: ENSMUST00000209174
AA Change: T163S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show a partial block in early thymopoiesis, increased double-negative T cell count, and increased sensitivity to anti-CD3 induced apoptosis. Homozygotes for another null allele show neonatal or postnatal lethality, reduced pro-B cell number, and abnormal pontine nuclei. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 231 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,278,306 T1059I probably benign Het
Abcb11 C T 2: 69,261,566 A871T probably damaging Het
Acot7 T C 4: 152,260,912 L313P probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Adam26b T A 8: 43,521,677 D96V probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Apbb1 A G 7: 105,574,227 V59A probably benign Het
Apc A G 18: 34,312,318 K722E probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Aspscr1 A G 11: 120,678,516 T47A probably damaging Het
Atr G A 9: 95,897,581 V1331I probably benign Het
Baz1a G A 12: 54,898,788 R1261* probably null Het
C2cd2l C A 9: 44,319,743 R49L probably benign Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1c A C 6: 118,610,544 M1287R probably damaging Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc177 A G 12: 80,759,239 V87A probably damaging Het
Ccdc178 T A 18: 22,097,723 I364F possibly damaging Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cep120 A G 18: 53,719,214 probably null Het
Cep128 G T 12: 91,022,491 probably null Het
Cep131 T C 11: 120,083,906 I23V probably benign Het
Cfc1 A G 1: 34,537,234 D125G probably damaging Het
Cfh T C 1: 140,136,788 K374R probably benign Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Clca1 C A 3: 145,007,778 M697I probably benign Het
Clec4a3 C T 6: 122,954,041 Q30* probably null Het
Cntnap3 T A 13: 64,740,592 R1232S probably benign Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Col12a1 T A 9: 79,633,468 I2412F probably damaging Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Cxcl2 C T 5: 90,904,158 T41I probably damaging Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Disp2 T C 2: 118,791,550 V921A probably damaging Het
Dnajc10 C G 2: 80,347,662 A671G probably benign Het
Dner T C 1: 84,370,784 I732V probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Dysf T C 6: 84,112,235 probably null Het
Eefsec T A 6: 88,376,205 K161* probably null Het
Ehhadh G C 16: 21,762,253 A663G probably benign Het
En1 A G 1: 120,603,621 S197G unknown Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Exph5 T C 9: 53,375,588 V1323A possibly damaging Het
Eya2 G T 2: 165,687,663 G109W probably damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Focad T C 4: 88,397,891 M1560T probably benign Het
Gadd45gip1 T A 8: 84,832,292 M1K probably null Het
Gbgt1 T C 2: 28,505,052 V234A possibly damaging Het
Gin1 T A 1: 97,786,104 D376E probably damaging Het
Git1 A T 11: 77,498,982 I24F probably damaging Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Gm5152 T C 5: 10,245,204 I90V possibly damaging Het
Gnptab T C 10: 88,436,095 Y916H probably benign Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Heg1 T G 16: 33,738,583 I1058S possibly damaging Het
Hivep3 A G 4: 120,095,174 Y229C probably benign Het
Idi1 T C 13: 8,890,411 F210L probably benign Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kat7 T G 11: 95,276,547 I455L possibly damaging Het
Kcnh5 G T 12: 75,114,229 P302T probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Krtap12-1 C T 10: 77,720,992 T123I possibly damaging Het
Ksr1 G A 11: 79,047,305 T49I probably damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lat2 T C 5: 134,606,369 H89R possibly damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Man2a2 T C 7: 80,362,438 E657G probably benign Het
Mfsd4a C T 1: 132,067,883 D4N possibly damaging Het
Mn1 G T 5: 111,420,014 A617S possibly damaging Het
Mov10 T C 3: 104,800,282 D592G probably damaging Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mtmr12 A T 15: 12,245,019 T207S probably benign Het
Musk G A 4: 58,293,563 V51M probably damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Naglu C T 11: 101,076,403 A393V possibly damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ncan T A 8: 70,108,086 T744S probably benign Het
Nlrp4c T A 7: 6,073,222 V707E probably damaging Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrcam A T 12: 44,571,675 Q822L probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1232 T A 2: 89,325,566 I205F probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pak1 T A 7: 97,904,695 V424E probably damaging Het
Pdcd6 G A 13: 74,304,041 T160I probably damaging Het
Phf21a C T 2: 92,360,299 T535M possibly damaging Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pkdrej G A 15: 85,820,427 T436I probably benign Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppil2 C G 16: 17,089,419 probably benign Het
Ppip5k2 A T 1: 97,728,957 H830Q probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A C 1: 133,356,457 K187Q probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep C G 1: 135,283,629 R127P probably benign Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G T 1: 120,063,246 E453D probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sema4a A G 3: 88,436,838 L702P possibly damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Shank2 A T 7: 144,179,853 N482Y probably damaging Het
Shc3 A T 13: 51,482,916 V72E probably damaging Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc45a4 A G 15: 73,586,038 I562T probably damaging Het
Smc6 T G 12: 11,317,853 V1088G probably benign Het
Snx32 C A 19: 5,496,111 R341L probably benign Het
Specc1 C T 11: 62,118,818 Q467* probably null Het
Spock3 A T 8: 63,348,947 N323I probably damaging Het
Stac3 A G 10: 127,507,766 K259R probably benign Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Stx3 A G 19: 11,785,523 I163T probably damaging Het
Suco A G 1: 161,827,655 probably null Het
Syngr4 A G 7: 45,888,722 F74S possibly damaging Het
Synpo2l G A 14: 20,665,819 P233S probably damaging Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tlk1 T C 2: 70,721,077 Y634C probably damaging Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Tox2 T C 2: 163,247,785 Y66H probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ttyh1 G A 7: 4,129,349 M261I probably benign Het
Ubap2 A G 4: 41,206,849 V509A probably benign Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Ucp3 G C 7: 100,482,720 M259I probably benign Het
Unc80 A T 1: 66,527,892 N886Y probably damaging Het
Vmn1r197 T A 13: 22,328,371 L154Q possibly damaging Het
Vmn1r40 T A 6: 89,714,315 M38K probably benign Het
Vmn2r78 C A 7: 86,920,789 Q172K probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfhx4 A T 3: 5,401,730 D2316V probably damaging Het
Zfp108 T C 7: 24,261,310 V442A probably damaging Het
Zfp260 A T 7: 30,104,806 T44S probably benign Het
Zfp873 C A 10: 82,060,707 T424N probably damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Zswim2 T A 2: 83,915,340 K585* probably null Het
Other mutations in Tcf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Tcf4 APN 18 69655019 missense probably damaging 1.00
IGL02131:Tcf4 APN 18 69564626 splice site probably benign
IGL02221:Tcf4 APN 18 69347367 missense probably damaging 1.00
IGL02420:Tcf4 APN 18 69564139 missense probably damaging 1.00
IGL02560:Tcf4 APN 18 69643022 unclassified probably benign
IGL02637:Tcf4 APN 18 69347350 missense probably damaging 1.00
IGL03056:Tcf4 APN 18 69651212 splice site probably benign
R0374:Tcf4 UTSW 18 69681812 splice site probably benign
R1265:Tcf4 UTSW 18 69642932 missense possibly damaging 0.93
R1794:Tcf4 UTSW 18 69657853 missense probably benign 0.44
R4703:Tcf4 UTSW 18 69657910 missense probably damaging 1.00
R4735:Tcf4 UTSW 18 69564155 missense possibly damaging 0.59
R4993:Tcf4 UTSW 18 69681769 missense probably damaging 1.00
R5191:Tcf4 UTSW 18 69642883 missense probably damaging 1.00
R5318:Tcf4 UTSW 18 69465430 missense possibly damaging 0.90
R5634:Tcf4 UTSW 18 69636847 missense possibly damaging 0.88
R6337:Tcf4 UTSW 18 69633580 missense probably damaging 1.00
R6658:Tcf4 UTSW 18 69657802 missense probably null 1.00
R6868:Tcf4 UTSW 18 69657650 intron probably null
R6907:Tcf4 UTSW 18 69652413 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATTCGGAAAGCGTCTCCCTTG -3'
(R):5'- TGACACAGCATGGTTCACAACGG -3'

Sequencing Primer
(F):5'- ACCGTGACTGAACGTCTTCT -3'
(R):5'- CAACGGAGCATGATGTTCAGTC -3'
Posted On2014-05-23