Incidental Mutation 'R1740:Slco6d1'
ID200250
Institutional Source Beutler Lab
Gene Symbol Slco6d1
Ensembl Gene ENSMUSG00000026336
Gene Namesolute carrier organic anion transporter family, member 6d1
Synonyms4921511I05Rik
MMRRC Submission 039772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1740 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location98421124-98516991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98428372 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 220 (I220M)
Ref Sequence ENSEMBL: ENSMUSP00000123850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027575] [ENSMUST00000160796] [ENSMUST00000162468]
Predicted Effect probably damaging
Transcript: ENSMUST00000027575
AA Change: I220M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027575
Gene: ENSMUSG00000026336
AA Change: I220M

DomainStartEndE-ValueType
Pfam:MFS_1 86 463 1.8e-13 PFAM
KAZAL 483 527 2.3e0 SMART
low complexity region 558 572 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160796
AA Change: I220M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123850
Gene: ENSMUSG00000026336
AA Change: I220M

DomainStartEndE-ValueType
Pfam:MFS_1 86 463 2.4e-13 PFAM
KAZAL 483 527 2.3e0 SMART
low complexity region 558 572 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162468
AA Change: I177M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125258
Gene: ENSMUSG00000026336
AA Change: I177M

DomainStartEndE-ValueType
Pfam:OATP 64 313 2.1e-27 PFAM
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,125 C417* probably null Het
4930548G14Rik G A 15: 46,625,489 noncoding transcript Het
Abcc12 T A 8: 86,505,497 K1311* probably null Het
Abcc12 T C 8: 86,509,771 D1138G possibly damaging Het
Adam32 A G 8: 24,921,298 S116P probably damaging Het
Arhgef26 C T 3: 62,423,583 L39F probably damaging Het
Babam1 T C 8: 71,403,019 I252T probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc109b A T 3: 129,918,727 H166Q probably benign Het
Ccdc61 G T 7: 18,903,937 probably benign Het
Ccdc89 C T 7: 90,426,738 S52F probably damaging Het
Cds2 T A 2: 132,302,213 I320N possibly damaging Het
Cebpe T C 14: 54,711,942 Y6C probably damaging Het
Cep250 T A 2: 155,973,356 I598N probably damaging Het
Cep350 T A 1: 155,928,833 I835F probably damaging Het
Ces3a T C 8: 105,048,685 L22P probably damaging Het
Cfap221 T C 1: 119,945,828 S490G probably benign Het
Cyp2j11 A G 4: 96,319,376 V234A probably benign Het
Dgat1 T C 15: 76,502,729 H399R probably damaging Het
Dnah10 A T 5: 124,773,190 probably null Het
Ebpl T G 14: 61,341,207 K193T probably benign Het
Elmsan1 T C 12: 84,172,902 E426G probably damaging Het
Entpd5 T C 12: 84,396,771 N66S probably benign Het
Fcgbp G T 7: 28,101,249 G1240V possibly damaging Het
Gabra5 A G 7: 57,421,842 S209P probably benign Het
Glce A T 9: 62,070,533 V23D probably damaging Het
Gm14226 GACTGTTAC GAC 2: 155,024,931 probably benign Het
Gtf2h1 A G 7: 46,812,466 N296S probably null Het
Herc6 T C 6: 57,652,065 S654P probably benign Het
Kcnk3 A T 5: 30,621,977 M124L possibly damaging Het
Lamb2 T G 9: 108,481,928 V281G probably damaging Het
Lctl A T 9: 64,133,107 D444V probably damaging Het
Mcm2 A G 6: 88,884,044 F891L probably damaging Het
Mical2 G T 7: 112,333,836 R739L probably benign Het
Mkrn2 G T 6: 115,613,369 A229S probably damaging Het
Mmp7 A G 9: 7,695,277 Y80C possibly damaging Het
Mpp2 T C 11: 102,062,396 probably null Het
Msh6 C A 17: 87,985,722 T635K possibly damaging Het
Mvd T A 8: 122,436,547 T315S probably benign Het
Myocd C T 11: 65,218,521 probably benign Het
Nav1 C T 1: 135,458,389 probably null Het
Olfr1298 T A 2: 111,645,869 I43F probably damaging Het
Pde4b A T 4: 102,487,351 D141V probably damaging Het
Pdgfrb A T 18: 61,081,833 D978V possibly damaging Het
Prss55 T C 14: 64,075,680 T252A probably damaging Het
Psd3 A T 8: 68,120,839 V230E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptprn A G 1: 75,262,050 V82A probably damaging Het
Ptpru G T 4: 131,793,678 probably null Het
Raph1 T A 1: 60,519,024 K258* probably null Het
Rnf25 A G 1: 74,598,727 V28A probably damaging Het
Slc25a4 C T 8: 46,208,503 V212M probably benign Het
Slc39a3 T C 10: 81,031,508 S135G probably damaging Het
Smim19 G T 8: 22,473,528 Y21* probably null Het
Speer4f1 A C 5: 17,478,761 Y141S probably damaging Het
Srgap2 G A 1: 131,289,388 P1062L probably benign Het
Stra8 A T 6: 34,927,719 probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem40 A G 6: 115,738,999 S76P probably benign Het
Unc13b C T 4: 43,240,285 R3569W probably damaging Het
Vmn1r128 A T 7: 21,349,944 Q191L probably benign Het
Washc2 T A 6: 116,231,632 probably benign Het
Other mutations in Slco6d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slco6d1 APN 1 98432230 splice site probably null
IGL00678:Slco6d1 APN 1 98496344 missense probably benign 0.01
IGL00790:Slco6d1 APN 1 98421200 utr 5 prime probably benign
IGL01694:Slco6d1 APN 1 98499845 missense probably damaging 1.00
IGL02003:Slco6d1 APN 1 98480768 missense probably damaging 1.00
IGL02059:Slco6d1 APN 1 98446806 missense possibly damaging 0.95
IGL02085:Slco6d1 APN 1 98443743 missense probably damaging 1.00
IGL02683:Slco6d1 APN 1 98480672 missense probably benign 0.05
IGL02736:Slco6d1 APN 1 98428311 missense possibly damaging 0.55
IGL03279:Slco6d1 APN 1 98466680 missense probably damaging 1.00
R0326:Slco6d1 UTSW 1 98490634 missense probably benign 0.02
R0359:Slco6d1 UTSW 1 98466697 missense probably benign 0.21
R0554:Slco6d1 UTSW 1 98466697 missense probably benign 0.21
R0589:Slco6d1 UTSW 1 98499747 splice site probably benign
R0733:Slco6d1 UTSW 1 98428269 nonsense probably null
R0883:Slco6d1 UTSW 1 98421399 missense probably benign 0.00
R1316:Slco6d1 UTSW 1 98466793 missense probably benign 0.02
R1370:Slco6d1 UTSW 1 98423094 missense probably benign 0.01
R1401:Slco6d1 UTSW 1 98490616 missense probably damaging 1.00
R1691:Slco6d1 UTSW 1 98507567 missense probably benign 0.34
R1767:Slco6d1 UTSW 1 98490549 missense possibly damaging 0.90
R1827:Slco6d1 UTSW 1 98421216 missense probably damaging 0.96
R2138:Slco6d1 UTSW 1 98443660 missense probably benign 0.19
R2849:Slco6d1 UTSW 1 98466716 missense probably benign 0.02
R3753:Slco6d1 UTSW 1 98499777 missense probably damaging 0.99
R4066:Slco6d1 UTSW 1 98463846 critical splice acceptor site probably benign
R4429:Slco6d1 UTSW 1 98496366 missense possibly damaging 0.66
R4480:Slco6d1 UTSW 1 98507574 nonsense probably null
R4656:Slco6d1 UTSW 1 98423203 missense probably benign 0.06
R4810:Slco6d1 UTSW 1 98423254 missense possibly damaging 0.83
R4814:Slco6d1 UTSW 1 98423174 missense probably benign 0.15
R5389:Slco6d1 UTSW 1 98443644 missense probably benign 0.00
R5504:Slco6d1 UTSW 1 98421339 missense probably damaging 0.99
R5619:Slco6d1 UTSW 1 98496222 missense probably damaging 1.00
R5688:Slco6d1 UTSW 1 98480768 missense probably damaging 1.00
R5820:Slco6d1 UTSW 1 98499778 missense probably damaging 0.97
R5878:Slco6d1 UTSW 1 98463836 splice site probably benign
R6261:Slco6d1 UTSW 1 98499863 missense probably benign 0.10
R6450:Slco6d1 UTSW 1 98421467 missense probably benign 0.29
R6452:Slco6d1 UTSW 1 98421212 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGGTGGACTATCCAGGGCATTACA -3'
(R):5'- CTCCCCATTCTCTCAGGGAAAGAGAAA -3'

Sequencing Primer
(F):5'- TGTCAGAACAGAATGCAAAGTATTG -3'
(R):5'- AAGCTTTTCAGTGACGTTTAGC -3'
Posted On2014-05-23